Labshake search
Citations for Takara Bio :
251 - 300 of 379 citations for IL 15 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... The human J chain was replaced with the DsRed2 gene of pDsRedN1 (Takara Bio, Shiga, Japan). The pIgR gene was inserted into the pEF-Myc-His vector (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: Human cell lines used in this study include U2OS and Lenti-X 293T (Takara Bio USA). Lenti-X 293T cells were only used for virus production ...
-
bioRxiv - Developmental Biology 2021Quote: ... 9 ul from each samples were directly used for cDNA amplification (15 cycles of LD PCR, using the SMART-Seq v4 Ultra Low Input RNA kit for sequencing (Takara Bio, #634898) and the SeqAmp DNA Polymerase (Takara Bio #638509) ...
-
bioRxiv - Immunology 2020Quote: ... The locus containing exons 11 through 15 of Copa was amplified off RP24-64H24 with FseI flanking ends and ligated into pEasyFloxDTA with Infusion recombination (Takara Bio USA) to form the 3’ homology arm.
-
bioRxiv - Cell Biology 2019Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... The forward primer contained a Kozak sequence and both primers contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). To make pmCherry-N1-Gal3 ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral supernatant was harvested 48 h after transfection and added to 6 well plates that had been precoated with 15 μg/ml RetroNectin (Takara Bio Inc.) and blocked with 2% BSA ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying the insert (5’-TACTTCCAATCCAATGTAGATATAAACAACAATAAGATTAGC-3’ and 5’- TTATCCACTTCCAATGAGATAACCTTGTACATCATCTGTATGC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used to amplify this region (5’-ATTGCGACACGTACTCTGCAGATCTCATACCATCATAGTTATAATATTAGC-3’ and 5’-AGAGGATCCCCATGGCTGCAGACACAGGTGTCGTCATTGTGA-3’) contained 15-bp overhang with homology to the plasmid for InFusion (Takara Bio, 638947) cloning and retained the Pst1 site ...
-
bioRxiv - Immunology 2020Quote: ... Cells were counted and seeded at 3 million cells in 1 mL of media with 2x hIL-2 into each well of a 6 well plate that was coated with 15 µg/mL of RetroNectin (Takara, Cat# T100A) for 3 hours at room temperature and subsequently washed with 1x PBS ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Total RNA was extracted from the whole bodies of a pool of 15 AM-treated larvae using the TaKaRa MiniBEST Universal RNA Extraction Kit (TaKaRa, Dalian, China) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cDNA was amplified by a polymerase chain reaction from a human brain cDNA library (Clontech, CA) using an appropriate primer pair ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The plasmid GFP-GT198 contained full-length human GT198 in a pEGFP-C3 vector (Clontech, 6082-1). HeLa cells transfected with GFP-GT198 (green ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA directed against human MAGI1 and AMOTL2 were constructed and cloned in the pSIREN-RetroQ vector (TaKaRa) according to the manufacturer’s conditions between BamHI and EcoRI cloning sites as previously described for other genes 75 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated from a human lung poly-A+ RNA (cat. 636105, Takara Bio, Kusatsu, Shiga, Japan) using a cDNA library construction kit (Takara Bio ...
-
bioRxiv - Immunology 2020Quote: The pIRES-DsRed2 and pDsRed2-C1 vectors used to express various human aquaporin constructs were from Clontech. The human pCMV6-AC-AQP9-GFP expression vector was from Origene ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pTT3-based IgG expression vectors with human constant regions (84) using In-Fusion cloning (Clontech), expressed in 293 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Human KCNQ2 cDNA (GenBank accession number NM_172108) in pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA) was used as template for in vitro mutagenesis ...
-
bioRxiv - Microbiology 2019Quote: ... the fragments of the pcAGGS/pcDNA3.1 vector and each target gene were amplified with a 15 bp homologous arm and were then fused using the In-Fusion HD Enzyme (Clontech, Felicia, CA, USA). To create the pcAGGS-huANP32B-Δ216/190/165 plasmids ...
-
bioRxiv - Cancer Biology 2019Quote: ... A full-length Myc tagged cDNA expressing human NEK9 (NM_001329237.1) was subcloned into the pVLX-Tight-Puro vector (Clontech). The RCC1 domain was deleted using the Quickchange® II XL Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Stratagene ...
-
bioRxiv - Cell Biology 2022Quote: ... a DNA fragment was PCR-amplified from human genomic DNA using Tks Gflex DNA Polymerase (#R060A, Takara Bio) and the primers listed in Table S1 ...
-
bioRxiv - Immunology 2023Quote: Wt or mutated human (h)ALPK1 cDNA constructs were cloned into the pCMV-myc plasmid (Takara Bio Inc) and were all siRNA resistant against the hALPK1 siRNA (s37074 ...
-
bioRxiv - Cell Biology 2023Quote: ... Full-length human CLUH and mouse Cluh coding sequences cDNA were cloned in pcDNA3 and pmCherry-N1 (Clontech), respectively ...
-
bioRxiv - Cancer Biology 2019Quote: ... 3 μg of total RNA was reverse transcribed to cDNA with Oligo(dT)15 primers using PrimeScript™ Reverse Transcriptase (Takara Bio, Shiga, Japan). The resultant cDNA was subjected to real-time PCR by using SYBR® Premix Ex Taq™ II (Takara Bio ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Each cDNA sample was amplified for the gene of interest and β-actin in a 15 µL reaction volume TB GreenTM Premix Ex Taq™ II (Takara, Tokyo, Japan). The PCR conditions were 95 °C for 30 s followed by 40 cycles of 95 °C for 5 s and 60 °C for 60 s ...
-
bioRxiv - Molecular Biology 2021Quote: ... was co-transformed with GAL4 DNA-BD-fused IPMK and a human brain cDNA activation domain (AD) library (Clontech). Two different reporter genes (HIS3 and ADE2 ...
-
bioRxiv - Neuroscience 2020Quote: ... we used Sanger sequencing of cDNA reverse transcribed from pooled human hippocampus poly-A-selected RNA (Takara/Clontech 636165) to support the presence of the human-specific intron-3 retention event identified within APOE (GRCh38 ...
-
bioRxiv - Neuroscience 2020Quote: ... we used Sanger sequencing of cDNA reverse transcribed from pooled human hippocampus poly-A-selected RNA (Takara/Clontech 636165) to support the presence of the human-specific intron-3 retention event identified within APOE (GRCh38 ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene expression profiles of mature hepatocytes were analyzed using human liver total RNA (636531, Clontech: Takara Bio, Shiga, Japan). Expression profiles of bile duct epithelial cells were obtained from Gene Expression Omnibus (GSM4454532 ...
-
bioRxiv - Cell Biology 2021Quote: ... Gene expression profiles of mature hepatocytes were analyzed using human liver total RNA (636531, Clontech: Takara Bio, Shiga, Japan). Expression profiles of bile duct epithelial cells were obtained from Gene Expression Omnibus (GSM4454532 ...
-
bioRxiv - Biophysics 2022Quote: Experiments were performed using PtK2 GFP-α-tubulin cells (stable line expressing human α-tubulin in pEGFP-C1, Clontech Laboratories ...
-
bioRxiv - Genomics 2022Quote: ... IgG and IgM 5’RACE AIRR-seq libraries were generated using the SMARTer Human BCR Profiling Kit (Takara Bio), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Human PDE4D5 wild type and PDE4D5-dN mutant were PCR amplified and cloned into pLVX-mCherry-N1 vector (Clontech) using Gibson assembly after vector digestion with XhoI and EcoRI ...
-
bioRxiv - Cell Biology 2020Quote: EGFP-Rab5 construct was generated by PCR amplifying human Rab5a from cDNA and subcloning into the pEGFP-C2 (Clontech) vector using XhoI/BamHI restriction sites ...
-
bioRxiv - Microbiology 2019Quote: ... Sequences encoding primate PBMs were added to the resulting pDONR221-mCherry-human GBP1DC_BglII vector following BglII digestion using Ligation-Independent cloning (In-Fusion, Clontech) with annealed oligomers that also restored human GBP1 Q580-L581 and the human GBP1 CaaX box (Table S9) ...
-
bioRxiv - Biophysics 2021Quote: ... PCR products were cloned into vector pcDNA3.3 (Thermo Fischer Scientific) for human IgG1 expression using In-Fusion cloning technology (Clontech) as described previously[1] ...
-
bioRxiv - Immunology 2021Quote: ... Antibodies were produced by transient transfection of human epithelium kidney 293T Lenti-X cells (Clontech Laboratories, Mountain View, CA) using the JetPrime transfection kit (Polyplus Transfection Illkirch ...
-
bioRxiv - Molecular Biology 2021Quote: ... Human eRF1 coding sequence was cloned into the XhoI and HindIII sites of the pλN-HA-C1 vector (Clontech). The pλN-HA-C1-eRF1 plasmid was then used to generate the pλN-HA-C1-eRF1AAQ (G183A G184A ...
-
bioRxiv - Cell Biology 2021Quote: ... US) and human cervical adenocarcinoma cells expressing a tetracycline-inducible repressor (HeLa Tet-Off, Clontech, Mountain View, California, US) were cultured in Dulbecco’s Modified Eagle Medium (DMEM ...
-
bioRxiv - Biophysics 2021Quote: The EGFR-GFP plasmid was constructed using the cDNA of human EGFR (pNeoSRαII) provided by Akihiko Yoshimura (Keio University) and was inserted into the pEGFP-C1 vector (Clontech) with the same linker sequence suggested by Carter and Sorkin (Carter and Sorkin ...
-
bioRxiv - Genomics 2023Quote: 200ng of RNA extracted from whole human blood used as input for reverse transcription using Smartscribe RT (Takara Clontech) with primers targeting the IGH constant regions (IDT ...
-
bioRxiv - Genomics 2023Quote: 200ng of RNA extracted from whole human blood used as input for reverse transcription using Smartscribe RT (Takara Clontech) with primers targeting the IGH constant regions (IDT ...
-
bioRxiv - Cancer Biology 2023Quote: ... Individual lentiCRISPRv2 vectors were introduced along with packaging vectors into human embryonic kidney (HEK) 293T cells via calcium phosphate transfection according to the manufacturer’s protocol (Clontech). Lentivirus was harvested at 48 and 72 hours after transfection in RPMI media supplemented with 10% FBS and filtered with 45 μm filters prior to transduction of cancer cell lines using centrifugation at 1000 g for 2 hours in the presence of 8 μg/mL of polybrene (Santa Cruz Biotechnology) ...
-
bioRxiv - Cell Biology 2023Quote: ... Gene expression profiles of mature hepatocytes were analyzed using human liver total RNA (636531, Clontech: Takara Bio, Shiga, Japan).
-
bioRxiv - Cell Biology 2023Quote: ... Gene expression profiles of mature hepatocytes were analyzed using human liver total RNA (636531, Clontech: Takara Bio, Shiga, Japan).
-
bioRxiv - Biochemistry 2024Quote: ... The sequence of human histone H2A(K15C-129) was cloned into the pCold-Trigger factor (TF) vector (Takara Bio) with a SUMO coding sequence inserted to generate His6–TF–SUMO–H2A(K15C-129 ...