Labshake search
Citations for Takara Bio :
251 - 300 of 445 citations for IL 10 Rat since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... in a 10 µL reaction volume with the PrimeScript RT Reagent Kit with gDNA Eraser (Takara) following the recommended protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... U2OSQ94 cells were cultured in DMEM +Glutamax supplemented with 10% Tet system approved FBS (Takara, 631368) and 1% Penicillin/Streptomycin ...
-
bioRxiv - Immunology 2023Quote: ... (Cat.No. 632180) were cultured in DMEM supplemented with 10% Tet System Approved FBS (Takara, Cat.No. 631106). All cell lines were cultivated at 37°C in a humidified atmosphere with 5% CO2.
-
bioRxiv - Physiology 2024Quote: ... 10 μM Reverse primer and TB Green Premix Ex Taq II (Tli RNaseH Plus) (Takara, #RR820W). Real-Time PCR was set up in a 384-well plate and run in a CFX384 Real-Time PCR System (BioRad ...
-
bioRxiv - Genetics 2019Quote: RNA oligo (10 pmol) were incubated with 2.5 U MazF (mRNA intereferase-MazF, Takara, code No. 2415A) in the 20 ul reaction mixture of MazF buffer (40 mM sodium phosphate (pH 7.5 ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: ... containing 10 μl of TB Green Premix Ex Taq II (Tli RNaseH Plus) (TaKaRa, #RP820A; Dalian, China) and 0.4 μM of each primer ...
-
bioRxiv - Immunology 2022Quote: ... Rearranged VDJ IGM and IGG amplicons were generated using a universal forward primer (Takara Bio;10 μM), and either an IgM-CH3 (5’-CAGATCCCTGTGAGTCACAGTACAC-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... LASVpp-BlaM virus was concentrated 10 times with Lenti-X concentrator (Clontech Laboratories, Mountain View, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... in a 20-μL reaction volume with 10 μL of 2× SYBR Premix Ex Taq II (TaKaRa), 2 μL of cDNA ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% Tet System Approved FBS (Clontech), 100 U/ml penicillin and 100 µg/ml streptomycin (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were incubated 30 min at RT and loaded onto a 10 μL aliquot of Talon (Takara) resin ...
-
bioRxiv - Immunology 2021Quote: ... Viral supernatants were collected after 48h and loaded onto retronectin-coated (10 ug mL−1, Takara Bio) non-TC 24-well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... 2019) and 10 fmol JF646-LANA (see below) in 0.5 nL phosphate-buffered saline (PBS, Takara, T900) containing 0.05% phenol red (SIGMA ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of total RNA was then reverse transcribed in 10 µL reactions using PrimeScript RT (TAKARA) and random hexamer primers ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was heat denatured and digested with 10-20 U of MazF enzyme (TakaRa, ref. 2415A) for 15 min at 37°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 AtCBLs prey vectors were co-transformed into the yeast strain AH109 following manufacturer’s instructions (Clontech, CA, USA). The empty vectors pTOOL27 and pTOOL28 were also co-transformed into yeast with each prey or bait plasmid respectively to confirm that bait does not autonomously activate the reporter genes in the absence of the prey protein.
-
bioRxiv - Genetics 2021Quote: ... followed by a final extension at 72 °C for 10 min by using Takara Taq polymerase (Clontech, #TAKR001). To remove the DsRed cassette ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ng of Renilla luciferase (pTK r.luc) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 100 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Biophysics 2021Quote: ... A total of 20 μl reaction system contains 10 μl 2X Premix Ex Taq II (TaKaRa, Dalian, China), 1 μl of 3D gene specific primer (forward ...
-
bioRxiv - Systems Biology 2022Quote: ... and deposited in 10 uL ice-cold lysis buffer containing 0.1% Triton-X 100 and RNase inhibitor (Takara) and stored at −80°C until further processing ...
-
bioRxiv - Zoology 2019Quote: ... 0.6 μL of 10 μM forward and reverse primers and 0.08 μL of 5.0U/ μL of Taq DNA polymerase (TAKARA), 1.5 μl of 10% Dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... The transcript abundance was measured in 10 µL volume of the SYBR Green PCR Master Mix (Takara, Japan) containing cDNA corresponding to 5 ng of total RNA with gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... 500 ng of total RNA was used in 10 μL PrimeScript™ RT Master Mix (TaKaRa, Tokyo, Japan) as described in the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set, Clontech Laboratories, Cat# 635651). The filtered supernatant was loaded onto the HisTALON cartridge (Clontech Laboratories ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... High-quality RNA (10 ng, RIN>9) was used to produce cDNA libraries using SmartSeq v4 (Clontech, 634888). cDNA was prepared into sequencing libraries using 150 pg of full-length cDNA amplicons with the Illumina® Nextera XT DNA Library Preparation Kit with dual index barcodes ...
-
bioRxiv - Biophysics 2022Quote: ... 10 μL of the reaction was then transformed into 100 μL of StellarTM competent cells (Takara Bio USA) and plated on kanamycin plates ...
-
bioRxiv - Genetics 2022Quote: ... 0.1-0.2*106 mESCs were seeded per well in a 24-12-well plate in conventional ESC medium and transduced the next day with 0.25-0.5 ml of 10:1 concentrated (lenti-X, Clontech) supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Neuroscience 2023Quote: All cells were cultured in high glucose DMEM with 10% Fetal Bovine Serum (tetracycline free, Clontech or Gibco) and penicillin/streptomycin 50units/ml-50 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 uL Maxima 5x RT buffer, 0.124 uL NxGen RNAse inhibitor, 0.25 uL SUPERase In, 1 uL 10 mM Takara dNTPs ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... Samples were incubated at 42 °C for 10 min with gDNA Eraser to remove the genomic DNA (Takara). PrimeScript RT Reagent Kit was used for RNA reverse transcription and cDNA synthesis ...
-
bioRxiv - Neuroscience 2023Quote: Genomic DNA was extracted from 10 whole bodies of wandering flies using MightyPrep reagent for DNA (Takara #9182). Whole body RNA was extracted from 10 whole bodies of wandering flies using TRIzol (Ambion #15596018) ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: Human embryonic kidney T-REx 293 cells which express the tetracycline repressor protein were purchased from Thermo Fisher Scientific and cultured in Eagle’s Minimum Essential Medium (MEM) GlutaMAX™ supplemented with 10% Tet system approved FBS (Clontech) and 5 μg/mL blasticidin ...
-
bioRxiv - Developmental Biology 2022Quote: ... https://www.addgene.org/112849/)10 between the EcoRI and SpeI restriction sites by multi-cassette assembly using the InFusion cloning kit (Takara Inc.). The correct sequence of the donor region was validated by Sanger sequencing.
-
bioRxiv - Molecular Biology 2021Quote: 20 cm plates of HEK293T cells were transfected with 10 µg of each plasmid using CalPhos transfection kit (Takara) according to manufacturer’s instructions and harvested 3 days later ...
-
bioRxiv - Molecular Biology 2020Quote: ... where each well contained 20 μL of reaction mixture consisting of: 10 μL SYBR Premix Ex Taq II (TaKaRa), 0.4 μL ROX Reference Dye (50× ...
-
bioRxiv - Immunology 2019Quote: ... Non-tissue culture treated 24-well plates were coated with 0.5 mL per well of 10 μg/mL RetroNectin (Takara) on day 1 and stored overnight at 4°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... The PCR reaction mixture (10 μl total volume) included 5 μl SYBR Premix Ex Taq II (TaKaRa, Dalian, China), 3.5 μl ddH2O ...
-
bioRxiv - Genomics 2021Quote: ... and then resuspended in 10 mM TAPS pH8.5 containing 1X DAPI and 1X secondary diluent reagent (Takara Cat# 640196) at a concentration of 400 nuclei/µL ...
-
bioRxiv - Molecular Biology 2021Quote: DIE cells were cultured in growth medium consisting of IMDM basal medium with 10% Tet system-approved FBS (Clontech) and 55μM 2-mercaptoethanol ...