Labshake search
Citations for Takara Bio :
451 - 500 of 666 citations for IL 10 Mouse since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Rearranged VDJ IGM and IGG amplicons were generated using a universal forward primer (Takara Bio;10 μM), and either an IgM-CH3 (5’-CAGATCCCTGTGAGTCACAGTACAC-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... LASVpp-BlaM virus was concentrated 10 times with Lenti-X concentrator (Clontech Laboratories, Mountain View, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... in a 20-μL reaction volume with 10 μL of 2× SYBR Premix Ex Taq II (TaKaRa), 2 μL of cDNA ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Plant Biology 2020Quote: ... The 20-µL reaction volume comprised 10 µL 2× SYBR Green PCR Master Mix (Takara, Dalian, China), 0.2 µM each primer ...
-
bioRxiv - Biochemistry 2020Quote: ... Cells were cultured in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% Tet System Approved FBS (Clontech), 100 U/ml penicillin and 100 µg/ml streptomycin (Gibco ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were incubated 30 min at RT and loaded onto a 10 μL aliquot of Talon (Takara) resin ...
-
bioRxiv - Immunology 2021Quote: ... Viral supernatants were collected after 48h and loaded onto retronectin-coated (10 ug mL−1, Takara Bio) non-TC 24-well plates ...
-
bioRxiv - Cell Biology 2022Quote: ... 2019) and 10 fmol JF646-LANA (see below) in 0.5 nL phosphate-buffered saline (PBS, Takara, T900) containing 0.05% phenol red (SIGMA ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Immunology 2023Quote: ... RNA extracted and amplified (10 ng RNA/sample) using SMART-Seq® HT kit (Takara Bio, #634455) according to the manufacture’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA was heat denatured and digested with 10-20 U of MazF enzyme (TakaRa, ref. 2415A) for 15 min at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... 500 ng of total RNA was then reverse transcribed in 10 µL reactions using PrimeScript RT (TAKARA) and random hexamer primers ...
-
bioRxiv - Neuroscience 2019Quote: ... and then incubated with a GFP antiserum (rabbit, 1:1000, Life Technology, #A6455) or an mCherry antiserum (mouse, 1:1000, Clontech, #632543). Primary antisera were diluted in PBS with 2% NGS overnight at 4°C ...
-
bioRxiv - Bioengineering 2019Quote: ... MO). The horseradish peroxidase (HRP)-conjugated monoclonal anti-His antibody (anti-mouse Cat. #631210) was obtained from Clontech (Mountain View, CA). The ultrasensitive HRP substrate used for Western blotting was from TaKaRa (Shiga ...
-
bioRxiv - Neuroscience 2020Quote: Bacterial expression plasmids encoding mouse and human WT-α-synuclein in the inducible pRK172 backbone were transformed into BL21-CodonPlus (DE3) cells (Clontech). Cell pellets were lysed in 0.75M NaCl ...
-
bioRxiv - Immunology 2020Quote: ... Tcrb amplicons were prepared using a 5’RACE-based protocol with the SMARTer Mouse TCR α/β Profiling Kit (Takara #634402) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Plant Biology 2019Quote: ... western blot and immuno-detection using monoclonal antibodies raised in mouse against the GAL4 activation or binding domain (1:10000 dilution, Clontech, www.clontech.com) following the Matchmaker Monoclonal Antibodies User Manuel from Clontech ...
-
bioRxiv - Genetics 2020Quote: ... Membranes were blocked in 5% milk for 1 h at room temperature and then probed with mouse-anti-EGFP (for pYFP constructs; 1:8000; Clontech, 632380) or mouse-anti-V5 tag (1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... A full-length Sfrp1 cDNA fragment was obtained by PCR amplifying mouse kidney cDNA using PrimeStar HS DNA polymerase (Takara Bio) following manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Neuroscience 2023Quote: ... The expression of GFP- or Venus-tagged constructs was measured by Western blot with mouse anti-GFP antibody (Clontech; 1:2,000). The expression of WT and mutant arrestin-3 was measured with rabbit polyclonal anti-arrestin-3 antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... 48-52 mCherry-positive cells from each mouse were sorted into 8-well strips containing SMART-Seq lysis buffer with RNase inhibitor (0.17 U/µL; Takara Cat#ST0764). For retrograde transsynaptic tracing ...
-
bioRxiv - Neuroscience 2023Quote: ... the SV40pA was replaced by the 3’UTR of msSOD2 (Kaltimbacher et al., 2006) amplified from mouse brain cDNA (Clontech 637301) using primers AA35 and AA36 and inserted into the XbaI and NotI sites ...
-
bioRxiv - Cell Biology 2024Quote: For immunostaining the following antibodies were used: mouse anti-E-cadherin mAb clones SHE78-7 and HECD1 (Takara, M126 and M106), mouse anti-vinculin (Sigma ...
-
bioRxiv - Plant Biology 2020Quote: ... 10 AtCBLs prey vectors were co-transformed into the yeast strain AH109 following manufacturer’s instructions (Clontech, CA, USA). The empty vectors pTOOL27 and pTOOL28 were also co-transformed into yeast with each prey or bait plasmid respectively to confirm that bait does not autonomously activate the reporter genes in the absence of the prey protein.
-
bioRxiv - Genetics 2021Quote: ... followed by a final extension at 72 °C for 10 min by using Takara Taq polymerase (Clontech, #TAKR001). To remove the DsRed cassette ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ng of Renilla luciferase (pTK r.luc) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 100 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Biophysics 2021Quote: ... and sgRNA were cultured at 37°C and 5% CO2 in high-glucose Dulbecco’s modified Eagle’s medium (DMEM, HyClone) supplemented with 10% (v/v) FBS (ClonTech), 250 µg/ml hygromycin ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Biophysics 2021Quote: ... A total of 20 μl reaction system contains 10 μl 2X Premix Ex Taq II (TaKaRa, Dalian, China), 1 μl of 3D gene specific primer (forward ...
-
bioRxiv - Systems Biology 2022Quote: ... and deposited in 10 uL ice-cold lysis buffer containing 0.1% Triton-X 100 and RNase inhibitor (Takara) and stored at −80°C until further processing ...
-
bioRxiv - Zoology 2019Quote: ... 0.6 μL of 10 μM forward and reverse primers and 0.08 μL of 5.0U/ μL of Taq DNA polymerase (TAKARA), 1.5 μl of 10% Dimethyl sulfoxide (DMSO ...
-
bioRxiv - Neuroscience 2020Quote: ... We coated 6-8 mg of 1.6 µm gold beads with 10-15 µg of EGFP-N1 (Clontech) or 20 μg pSuper-cofilin1-shRNA + 20 μg pSuper-ADF-shRNA (Bosch et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... The transcript abundance was measured in 10 µL volume of the SYBR Green PCR Master Mix (Takara, Japan) containing cDNA corresponding to 5 ng of total RNA with gene-specific primers ...
-
bioRxiv - Microbiology 2021Quote: ... 500 ng of total RNA was used in 10 μL PrimeScript™ RT Master Mix (TaKaRa, Tokyo, Japan) as described in the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... column was equilibrated with 10 column volumes of Equilibration Buffer (HisTALON™ Buffer Set, Clontech Laboratories, Cat# 635651). The filtered supernatant was loaded onto the HisTALON cartridge (Clontech Laboratories ...
-
Immunoresolvents Support Skeletal Myofiber Regeneration via Actions on Myeloid and Muscle Stem CellsbioRxiv - Immunology 2020Quote: ... High-quality RNA (10 ng, RIN>9) was used to produce cDNA libraries using SmartSeq v4 (Clontech, 634888). cDNA was prepared into sequencing libraries using 150 pg of full-length cDNA amplicons with the Illumina® Nextera XT DNA Library Preparation Kit with dual index barcodes ...
-
bioRxiv - Biophysics 2022Quote: ... 10 μL of the reaction was then transformed into 100 μL of StellarTM competent cells (Takara Bio USA) and plated on kanamycin plates ...
-
bioRxiv - Genetics 2022Quote: ... 0.1-0.2*106 mESCs were seeded per well in a 24-12-well plate in conventional ESC medium and transduced the next day with 0.25-0.5 ml of 10:1 concentrated (lenti-X, Clontech) supernatant with 8 ng/μl polybrene (Sigma Aldrich) ...
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Neuroscience 2023Quote: All cells were cultured in high glucose DMEM with 10% Fetal Bovine Serum (tetracycline free, Clontech or Gibco) and penicillin/streptomycin 50units/ml-50 mg/ml ...
-
bioRxiv - Neuroscience 2022Quote: ... 4 uL Maxima 5x RT buffer, 0.124 uL NxGen RNAse inhibitor, 0.25 uL SUPERase In, 1 uL 10 mM Takara dNTPs ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... Samples were incubated at 42 °C for 10 min with gDNA Eraser to remove the genomic DNA (Takara). PrimeScript RT Reagent Kit was used for RNA reverse transcription and cDNA synthesis ...
-
bioRxiv - Neuroscience 2023Quote: Genomic DNA was extracted from 10 whole bodies of wandering flies using MightyPrep reagent for DNA (Takara #9182). Whole body RNA was extracted from 10 whole bodies of wandering flies using TRIzol (Ambion #15596018) ...
-
bioRxiv - Biochemistry 2020Quote: A yeast displayed cDNA library that concurrently displays NanoLuc (diversity ∼6×106) was constructed using DNA amplified from the Clontech Mate & Plate Library-Universal Mouse (Normalized) cDNA library (Takara Bio Inc). The yeast library was generated using the previously described lithium acetate yeast transformation method (63) ...