Labshake search
Citations for Takara Bio :
351 - 400 of 6008 citations for Human V Set And Immunoglobulin Domain Containing Protein 2 VSIG2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Plant Biology 2021Quote: ... A 1 μg aliquot of RNA was used for the synthesis of the cDNA first strand using a PrimeScriptTMRT reagent Kit containing gDNA eraser (TaKaRa, Shiga, Japan). The cDNA was used as the template and primers in TableS1 were used to PCR amplify the sequence ...
-
bioRxiv - Cell Biology 2023Quote: ... and subcloned into a modified pCaSpeR4 vector containing the αTub84B promoter (Marois et al., 2006) using In-Fusion cloning kit (Takara Bio, Japan). Forward primer sequence was 5’-CTAGAGGATCCCCGGGTACCATGGTGAGCAAGGGCGAG-3’ and reverse primer sequence was 5’-TCGAGGGGGGGCCCGGTACCTTAATTGTAAGTAATACTAGATCCAGGGTATAAAGTT GTTC-3’ ...
-
bioRxiv - Cell Biology 2023Quote: The pCAG-MDM4 expression vector was established by cloning of MDM4 sequence into a pCAG vector47 containing a multiple cloning site (pCAG-MCS) using In-Fusion® Snap Assembly Starter Bundle kit (#638945; Takara Bio). A single restriction digest was performed on the pCAG-MCS vector using XhoI (Cat ...
-
bioRxiv - Molecular Biology 2024Quote: The full length BRD4 DNA fragment was amplified by PCR from pcDNA4-TO-HA-BRD4FL (Addgene plasmid #31351)61 incorporated into linearized FM5 lentiviral vectors containing standardized linkers (generously provided by David Sanders) using the In-Fusion HD cloning kit (Takara Bio, 638910). BRD4dN-mCh-sspB (Addgene plasmid #121968)31 and NLS-iLID-Ferritin (Addgene plasmid #122147)40 were originally developed and characterized in previous Brangwynne lab studies ...
-
bioRxiv - Immunology 2022Quote: ... 25 μg of the retroviral expression vector (pLZRS-human codon-optimized Bcl6-P2A-human codon-optimized BclxL-IRES-GFP) and 5 μg of the envelope vector (p10A1; Clontech) were transfected into GP2-293 cells using Lipofectamine 3000 (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... A human Podocin-N fragment cDNA with 3xFLAG was amplified by PCR using a human kidney cDNA in Human MTC Panel I (TaKaRa) as a template ...
-
bioRxiv - Cell Biology 2023Quote: Primers designed to flank the MLR of human CDHR5 were used for PCR reactions with Human Small Intestine QUICK-Clone cDNA (Clontech) as the template ...
-
bioRxiv - Neuroscience 2021Quote: ... Mutagenesis of pMU2-Camk2b was conducted by inverse PCR with Mighty Cloning Reagent Set (Blunt End) (Takara Bio, Japan) following to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2020Quote: ... Cells were originally obtained from the ATCC and routinely tested negative for mycoplasma contamination (PCR Mycoplasma Detection Set, Takara).
-
bioRxiv - Genetics 2020Quote: ... 0.1 μM final each primer in the set and 2.5 U TaKaRa Taq™ DNA Polymerase (TaKaRa, cat. R001A). Cycling was performed using a touch-down approach ...
-
bioRxiv - Immunology 2019Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Biochemistry 2022Quote: ... Human DOCK10 DNA was synthesized by Clontech (NM_014689). The DHR2 domain of human DOCK11 DNA (NM_144658.3 ...
-
bioRxiv - Neuroscience 2020Quote: ... Feeder-free human iPSC line (XY) from Takara was obtained on six well plates (catalog # 3506 ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Rab1B was cloned into pEGFP-C1 (Clontech) using XhoI and BamHI restriction sites and verified by sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Human iPSC line (XY) was obtained from Takara, and Human H9 ESC line (WA09 ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Systems Biology 2022Quote: Following the transfer of samples into a 384-well plate containing RT-PCR buffer with 3’ SMART-Seq CDS Primer IIA (SMART-Seq® v4 PLUS Kit, TaKaRa, cat# R400753); the samples were immediately denatured at 72ºC for 3 min and chilled on ice for at least 2 min ...
-
bioRxiv - Cell Biology 2020Quote: ... containing 100 ng/ml Doxycycline (Clontech #631311) and 0.1 μl RNAiMAX per pmol siRNA (Thermofisher Scientific #13778150 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR fragments containing pLib vector backbone (Clontech) and EF1A promoter ...
-
bioRxiv - Microbiology 2020Quote: ... Total protein was extracted from 2,000 midguts using the lysis buffer supplied in the Capturem IP & Co-IP kit (Takara, 635721). The extracted proteins were divided into two equal parts and used for immunoprecipitation (IP) ...
-
bioRxiv - Biophysics 2020Quote: pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or Seamless Ligation Cloning Extract (SLiCE ...
-
bioRxiv - Genomics 2021Quote: ... Target regions were amplified by PCR using specific primer sets and high-fidelity PrimeSTAR GXL DNA polymerase (Takara, Shiga, Japan). Sanger sequencing was performed using BigDye Terminator reactions and loaded onto a 3730xl DNA analyzer (Applied Biosystems ...
-
bioRxiv - Plant Biology 2020Quote: ... Signal peptide– truncated cDNA fragments of AVRs were amplified by PCR by using primer set (Table S2) and inserted into EcoRI and BamHI sites of pGADT7 (prey) or pGBKT7 (bait) vectors (Clontech). sHMA cDNAs were synthesized from total RNAs of rice leaves (cultivar Sasanishiki ...
-
bioRxiv - Plant Biology 2020Quote: ... The KK fragment was then amplified from PVX/KK using different sets of primers (Supplemental Table S1) and subcloned into pMD19-T (TAKARA), the BbsI site of pBluescript SK+/OsU6 (Feng et al ...
-
bioRxiv - Cell Biology 2023Quote: ... was PCR-amplified with the primer set (fwd: 5’- CTTCGAATTCTGGCCACCATGGCTGCCGCCACCACC-3’, rev: 5’- CGGTGGATCCccCAAGAAATCCTTGATGTTAAGATCCGCTAATGG-3’) and inserted into EcoRI and BamHI sites of pmCherry-N1 (Clontech) by restriction digestion and T4 ligation ...
-
bioRxiv - Genomics 2023Quote: ... were used for the genomic DNA (gDNA) extraction with NucleoBond AXG 100 or AXG 500 with NucleoBond Buffer Set IV (Clontech) or DNeasy Blood and Tissue kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... The V1-V2 variable region of stool DNA was amplified by universal primer set 27F-mod (5’-AGRGTTTGATYMTGGCTCAG-3’) and 338R (5’-TGCTGCCTCCCGTAGGAGT-3’) using Gflex DNA polymerase (Takara) 37 ...
-
bioRxiv - Immunology 2023Quote: ... The components of the master mix for the PCR and the PCR programs were set up according to the CloneAmp HIFI PCR protocol (Takara). All generated plasmids were sequenced before use (Eurofins Genomics).
-
bioRxiv - Biophysics 2023Quote: ... Proteins were purified via immobilized metal affinity chromatography (IMAC) with TALON metal affinity cobalt resin and its associated buffer set (Takara), following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...