Labshake search
Citations for Takara Bio :
401 - 450 of 5054 citations for Human Transcription factor HIVEP2 HIVEP2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... The reverse transcription step was performed using Takara’s PrimeScriptTM RT Master Mix (RR036A; Takara, Japan). A brilliant SYBR green PCR master mix (4913914 ...
-
bioRxiv - Genomics 2022Quote: ... ten 50μL reverse transcription reactions were carried out using PrimeScript™ Reverse Transcriptase (Takara, #2680) and a gene specific primer (STARR_GSP ...
-
bioRxiv - Cell Biology 2023Quote: ... and reverse transcription was performed using RNA to cDNA EcoDry™ Premix (Clontech – Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Pathology 2022Quote: Reverse transcription PCR (RT-PCR) was performed with 500 ng RNA per reaction by TaKaRa PrimeScriptTM RT Master Mix (Perfect Real Time ...
-
bioRxiv - Cell Biology 2023Quote: ... and reverse transcription was performed using RNA to cDNA EcoDry™ Premix (Clontech – Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human total RNA from different normal tissues from Clontech (Human Total RNA Master Panel II,Cat# ...
-
bioRxiv - Cell Biology 2019Quote: ... and human BaxS184V was cloned in pEGFP-C1 (Clontech). Bax/Bak DKO MEFs were grown in DMEM supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2019Quote: ... Human colon cDNA purchased from Clontech (Palo Alto, CA) was used as the template ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2021Quote: ... and human-specific GFAP marker STEM123 (TaKaRa, cat. Y40420). As general astrocyte markers GFAP (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... Normal human stomach tissue RNAs were purchased from TaKaRa Bio (Shiga ...
-
bioRxiv - Immunology 2019Quote: ... and Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2020Quote: Human induced pluripotent stem cells (iPSCs) (ChiPSC18, Takara Bioscience) were reprogrammed using a protocol for midbrain dopaminergic neurons adapted from Kirkeby et ...
-
bioRxiv - Cell Biology 2020Quote: Human telomerase-immortalized retinal-pigmented epithelial cells (RPE1; Clontech) either expressing LifeAct-GFP or parental (Vignaud et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... human CCDC22 was first cloned into pEGFP-C1 (Clontech) between Sal1 and BamH1 ...
-
bioRxiv - Microbiology 2023Quote: ... and the Mate and Plate Universal Human Library (Clontech). This yeast two-hybrid universal library was constructed from human cDNA that has been normalized to remove high copy number cDNAs (overrepresented transcripts ...
-
bioRxiv - Genetics 2023Quote: ... Human KISS1 was cloned into pLVX-neo vector (Clontech) for overexpression ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human iPSC line ChiPSC22 (Cellartis/Takara Bio Europe AB) was cultivated in the feeder-free DEF-CS system (Cellartis/Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2020Quote: ... JEG3 cells (human; sex: female, placenta epithelial), HEK293 derivative Lenti-X™ 293T cells (human; sex: female, kidney epithelial) obtained from Takara (cat. 632180), Huh-7.5 heptoma cells (human ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: Human CaMKII-α (Uniprot_ID: Q9UQM7) and human CaMKII-β (Uniprot_ID: Q13554) were cloned into the pEGFP-C1 vector backbone (Clontech, Mountain View, CA), after modifying the vector to contain a biotinylation sequence (Avitag ...
-
bioRxiv - Cell Biology 2021Quote: ... and reverse transcription of 2 μg of RNA was performed using PrimeScript RT Master Mix (TaKaRa). RT-qPCR was performed with SYBR Premix Ex Taq ((Tli RNaseH Plus) ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription and first strand cDNA synthesis was performed using PrimeScript Reverse Transcriptase (Takara Bio Inc.). For gene expression analysis ...
-
bioRxiv - Systems Biology 2021Quote: ... 500 ng total RNA was used for reverse transcription with PrimeScript RT with gDNA eraser (Takara). For relative transcript quantification PowerUp SYBR Green (Applied Biosystems ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Transcription template DNA fragments were amplified directly by PCR using PrimeStar Max PCR polymerase (Takara Bio), SPu-2 (5’–CAGTAAGCCAGATGCTACAC ...
-
bioRxiv - Molecular Biology 2021Quote: ... Reverse transcription was carried out using PrimeScript RT Master Mix (Takara Bio, Otsu, Japan. Ref: RR036A). Optical density analysis using a Nanodrop ND-1000 spectrophotometer (Labtech ...
-
bioRxiv - Molecular Biology 2022Quote: ... was used for oligo(dT)18-primed cDNA synthesis according to the reverse transcription protocol (TaKaRa). The resulting cDNA was subjected to relative quantitative PCR using the SYBR Premix Ex Taq kit (TaKaRa ...
-
bioRxiv - Immunology 2023Quote: ... The viral copies were quantitated by reverse transcription quantitative PCR following the handbook (Takara, Cat.#RR086A). The copy numbers of reverse-transcripts from cell cultures and mice organ samples were normalized with the expression level housekeeping gene of beta-actin by using the 2(-Delta Delta C(T) ...
-
bioRxiv - Genetics 2023Quote: ... Reverse transcription and quantitative real-time PCR were performed with PrimeScriptTM RT Master Mix (Takara, RR037A) and TB Green Premix Ex TaqTM II (Takara ...
-
bioRxiv - Neuroscience 2024Quote: ... which was conducted using oligo-dT-primed reverse transcription with SMARTScribe reverse transcriptase (Clontech, Cat#: 639538) and a locked nucleic acid containing template-switching oligonucleotide (TSO ...
-
bioRxiv - Developmental Biology 2024Quote: ... and cDNA synthesis was followed by retrotranscribing reverse transcription with primer transcript II reverse transcriptase (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... 400 ng of RNA was used for reverse transcription using PrimeScript RT Master Mix (Takara, USA). PCR reactions were performed using TB Green Premix Ex Taq (Takara ...
-
bioRxiv - Cell Biology 2019Quote: ... Human cript gene was also cloned into pEGFP-N1 (Clontech) using XhoI and BamHI to generate pEGFP-cript ...
-
bioRxiv - Neuroscience 2021Quote: ... and Human Brain Cerebral Cortex Total RNA (Takara Cat. #636561) was reverse-transcribed by Maxima H Minus First Strand cDNA Synthesis Kit (Thermo Scientific ...
-
bioRxiv - Genomics 2019Quote: ... Human Universal Reference Total RNA (Takara Bio/Clontech, labeled A), a mixture of 23 normal human tissues (including brain ...
-
bioRxiv - Genomics 2019Quote: ... Human Universal Reference Total RNA (Takara Bio/Clontech, labeled A), a mixture of 23 normal human tissues (including brain ...
-
bioRxiv - Cancer Biology 2020Quote: ... The primary antibody rabbit anti-human Cas9 Polyclonal Antibody (Clontech) was diluted 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... STEM121 (human cytoplasm, 1:2000; Y40410, Takara, Mountain View, CA), overnight at room temperature to detect engrafted cells ...
-
bioRxiv - Cell Biology 2021Quote: Human embryonic kidney 293 T cells (HEK293T, Takara, Cat# 632180) were cultured in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Cell Biology 2020Quote: ... EGFP-tagged human β-actin (Clontech, Mountain View, CA, USA) was used ...
-
bioRxiv - Biochemistry 2019Quote: ... were amplified from a fetal human brain cDNA library (Clontech) by PCR and checked by automated sequencing.
-
bioRxiv - Neuroscience 2020Quote: ... Control RNA was either Universal Human RNA (UHR) (Takara 636538) or control RNA provided in the SMART-Seq v4 kit ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the cDNA from pooled human tissues was purchased from Takara Bio Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... The Human Mitochondrial DNA Monitoring Primer Set (TaKaRa, Cat # 7246) was used to determine mitochondrial DNA (mtDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... Control RNA was either Universal Human RNA (UHR) (Takara 636538) or control RNA provided in the SMART-Seq v4 kit ...
-
bioRxiv - Immunology 2022Quote: ... RetroNectin® Recombinant Human Fibronectin Fragment (Takara Bio, Cat#T100A), Recombinant Murine Flt3-Ligand (Peprotech ...
-
bioRxiv - Microbiology 2022Quote: Human liver cDNA library was obtained from Clontech (California, USA). Dual Luciferase reporter assay kit and CellTiter96 Aqueous one solution cell proliferation assay kits were from Promega (Madison ...
-
bioRxiv - Neuroscience 2022Quote: ... Control RNA was either Universal Human RNA (UHR) (Takara 636538) or control RNA provided in the SMART-Seq v4 kit ...
-
bioRxiv - Neuroscience 2023Quote: Five ug of total RNA from human total brain (Clontech) was reverse transcribed using GeneRacer oligo-dT primer and SuperScript III First-Strand Synthesis System (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human FCHO1 was cloned into pEGFPC1 (Clontech, Mountain View, CA). All constructs were sequence verified prior to use.