Labshake search
Citations for Takara Bio :
1 - 50 of 6338 citations for Human Interleukin 1 Family Member 10 IL1F10 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Biochemistry 2020Quote: ... viral titer was determined using the lentiviral p24 ELISA kit from Takara Bio (MountainView ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral titers were determined using the LentiX-p24 Rapid Titer ELISA kit (Takara). All cell culture reagents were obtained from ThermoFisher Scientific ...
-
bioRxiv - Cancer Biology 2023Quote: ... Concentrated viruses were titered using the p24-Elisa kit (Takara Bio, cat. 632200) following manufacturer’s protocols ...
-
bioRxiv - Systems Biology 2020Quote: Human mitochondrial to nuclear DNA ratio kit (Takara) was used to assess mitochondrial DNA content ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA of Human Phosphodiesterase type 10 (hPDE10) was amplified by conventional nested PCR using human brain cDNA (Clontech). cDNAs template encoding wild-type and D674A mutant form of hPDE10 catalytic domain (CD ...
-
bioRxiv - Bioengineering 2020Quote: ... and 21 were measured with an enzyme immunosorbent assay (ELISA) kit (Takara, Shiga, Japan).
-
bioRxiv - Neuroscience 2020Quote: ... which were determined by an ELISA Adeno-X Rapid Titer Kit (Cat#: 631028, Takara). It detects the Adenoviral Hexon surface antigen ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus titer was determined with Lenti-X™ p24 Rapid Titration ELISA Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... 10 ng cDNA of various tissues (Takara Human MTC panel I & II) were used for each reaction and amplified by KOD Xtreme Hot Start DNA polymerase kit (Takara) ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Microbiology 2020Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Monocytes were infected immediately after purification by adding HIV-1BaL virus to the culture at MOI between 3 and 5 based on the p24 titer ...
-
bioRxiv - Microbiology 2022Quote: ... Viral titer was determined by the ELISA p24 antigen assay (Lenti-X p24 Rapid Titer Kit, TaKaRa). Infections of fully differentiated MDM were performed after adherent growth in the presence of M-CSF for seven days ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Bioengineering 2021Quote: ... The virus titre was calculated using the ELISA-based Lenti-X™ p24 Rapid Titer Kit (Takara Bio) following the manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... STEM121 (human cytoplasm, 1:2000; Y40410, Takara, Mountain View, CA), overnight at room temperature to detect engrafted cells ...
-
bioRxiv - Cell Biology 2023Quote: Diploid human retinal pigment epithelium hTERT-RPE 1 cells (Clontech) were grown in DMEM/F-12 (Gibco ...
-
bioRxiv - Neuroscience 2022Quote: ... and either 4 wells of 10 pg of Human Universal Reference Total RNA (Takara 636538) or 2 wells of 10 pg of Human Universal Reference and 2 wells of 10 pg Control RNA provided in the Clontech kit ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Cancer Biology 2019Quote: ... The human patient PDX cell lines were maintained in RPMI-1640 medium containing 10% FBS (Clontech). KRAS mutation status ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-human GFAP (mouse IgG1, 1:2000, Takara Bio, Shiga, Japan), anti-CNPase (mouse IgG1 ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10 U μl–1 SMARTScribe (Clontech) and 10 U μl–1 RNASin plus (Promega) ...
-
bioRxiv - Systems Biology 2023Quote: ... before library preparation using the SMARTer Human TCR α/β Profiling Kit (Takara Bio). In brief ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and titer quantified using p24 ELISA antigen assay (Takara). MOI=5 was used to transduce 1x1097 EndoC-βH3 cells in culture media without pen/strep and puromycin.
-
bioRxiv - Genomics 2022Quote: Sequencing libraries were prepared using 1-10 ng of cfDNA and the ThruPLEX® Plasma-seq Kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... 1 μL of 10 mM dNTPs (Takara), 1 μL of 10 μM TSO primer (5’-AAGCAGTGGTATCAACGCAGAGTACATrGrGrG-3’) ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Neuroscience 2021Quote: ... Groups of 6-10 cells were dispensed from the micropipette into 1 µl ice-cold 10x reaction buffer (SMART-Seq v4 kit, Takara) and flash-frozen before library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CDS of fluorescent proteins were subcloned into pET-human αSyn51 using the KOD-Plus Mutagenesis kit (TOYOBO) and In-Fusion HD Cloning Kit (Takara Bio) according to the manufacturers’ protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... The human ezrin sequence was cloned into a pEGFP-N1 (Clontech; 6085-1). The human MISP and EGFP-MISP sequences were subcloned into modified pFastBac-6xHis-MBP plasmid LIC expression vector (Addgene ...
-
bioRxiv - Genomics 2024Quote: Illumina sequencing libraries are prepared by incorporating 1-10 ng of cfDNA with the ThruPLEX® Plasma-seq Kit by Takara Bio ...
-
bioRxiv - Neuroscience 2023Quote: ... Human cDNA for α7-nAChRs and NACHO inserts were cloned using In-fusion cloning kit (Takara). After cloning in the lentiviral transfer plasmids ...
-
bioRxiv - Neuroscience 2020Quote: ... Transplanted hiOLs were identified using anti-human cytoplasm (STEM121; Takara, Y40410, IgG1, 1:100), anti-human nuclei (STEM101 ...
-
bioRxiv - Cell Biology 2021Quote: ... The human fimbrin sequence was cloned into a pEGFP-C1 plasmid (Clontech; 6084-1). The human ezrin sequence was cloned into a pEGFP-N1 (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... 10 U ml−1 of HRV- 3C protease (Takara) were added to the Ni-NTA eluted protein to remove the oligohistidine- GST-tag during dialysis against 3 L of dialysis buffer I (25 mM Tris-HCl ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 μL (1 mU) of Pfu PGAP (TaKaRa) was added ...
-
bioRxiv - Microbiology 2020Quote: ... and 10 U μl−1 PrimeScript Reverse Transcriptase (Takara) at 48 °C for 30 min ...
-
bioRxiv - Physiology 2020Quote: ... containing 1 μL of 10× reaction buffer (SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing, Cat. No. 634888, Takara Bio, Kusatsu, Japan). Nuclease-free water was added to 11.5 μL ...
-
bioRxiv - Cell Biology 2019Quote: Human MPS1 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Cell Biology 2020Quote: Human CDC20 was amplified from human testis cDNA (Marathon cDNA; Takara Bio Inc.) using Pfu polymerase (Agilent Technologies) ...
-
bioRxiv - Genomics 2023Quote: ... 1 μl of 5’ linker (10 μM) was ligated with 10 μl of Mighty mix (DNA Ligation Kit
, catalog num. 6023, Takara) to 4 μl of the sample coming from the previous step ... -
bioRxiv - Physiology 2019Quote: Human TMEM206 was cloned from cDNA obtained from a human brain cDNA library (Clontech) using the following primers:
-
bioRxiv - Microbiology 2022Quote: ... RNA samples with sufficient material (10 pg–10 ng) were passed to whole-transcriptome library preparation using the SMART-Seq v4 PLUS Kit (Takara Bio) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... RNA samples with sufficient material (10 pg–10 ng) were passed to whole-transcriptome library preparation using the SMART-Seq v4 PLUS Kit (Takara Bio) following the manufacturer’s instructions ...