Labshake search
Citations for Takara Bio :
151 - 200 of 5341 citations for Human G protein coupled receptor 42 GPR42 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Feeder-free human iPSC line (XY) from Takara was obtained on six well plates (catalog # 3506 ...
-
bioRxiv - Immunology 2021Quote: ... Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2022Quote: ... Human embryonic kidney cells Lenti-X 293T (Clontech) were cultured in DMEM media supplemented with 10% FBS (Gibco) ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Sec24B was subcloned into pmCherry-C1 (Clontech) using SalI and BglII restriction sites and verified by sequencing ...
-
bioRxiv - Cell Biology 2019Quote: ... Human Rab1B was cloned into pEGFP-C1 (Clontech) using XhoI and BamHI restriction sites and verified by sequencing ...
-
bioRxiv - Developmental Biology 2019Quote: ... Human iPSC line (XY) was obtained from Takara, and Human H9 ESC line (WA09 ...
-
bioRxiv - Biochemistry 2021Quote: ... Human embryonic kidney EcoPack 2–293 cells (Clontech) were cultivated on collagen-coated (Collagen R ...
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Cancer Biology 2021Quote: ... using Takara’s Lenti-X (VSV-G) Packing Single Shots (Takara Bio/ Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2020Quote: The cDNA coding sequences of the first and second cytoplasmic loop domain of human TMEM39A were cloned into the pGBKT7 vector and screened against a normalized universal human cDNA library (Clontech, 630481), following instruction of the Matchmaker® Gold Yeast Two-Hybrid System (Clontech ...
-
bioRxiv - Genetics 2020Quote: The cDNA coding sequence of the C-terminal domain of human TMEM132D was cloned into the pGBKT7 vector and screened with a normalized universal human cDNA library (Clontech, 630481) in pGADT7 Vector ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Microbiology 2020Quote: ... Total protein was extracted from 2,000 midguts using the lysis buffer supplied in the Capturem IP & Co-IP kit (Takara, 635721). The extracted proteins were divided into two equal parts and used for immunoprecipitation (IP) ...
-
bioRxiv - Biophysics 2020Quote: pDNA_HaloTag/SNAP-tag/GFP vectors encoding each target protein (see Note 1),which were inserted by In-Fusion HD Cloning Kit (Clontech) or Seamless Ligation Cloning Extract (SLiCE ...
-
bioRxiv - Microbiology 2022Quote: ... and E484Q mutations of the SARS-CoV-2 spike protein were determined by qPCR using mutation detection kits purchased from Takara Bio (Shiga ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cells were transfected with the LentiX VSV-G transfection mix (Clontech) and different SARS-CoV-2 ORFs (cloned into pLX vector) ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD2.G using TransIT-293 Transfection Reagent (TaKaRa, Cat# V2700) in Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... and pCMV-G using Calphos transfection reagent (Clontech, Takara, Jusatsu, Japan). Medium was changed 16 hours after transfection ...
-
bioRxiv - Immunology 2023Quote: ... and pCMV-G using Calphos transfection reagent (Clontech, Takara, Jusatsu, Japan). Medium was changed 16 hours after transfection ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human total RNA from different normal tissues from Clontech (Human Total RNA Master Panel II,Cat# ...
-
bioRxiv - Cell Biology 2019Quote: ... and human BaxS184V was cloned in pEGFP-C1 (Clontech). Bax/Bak DKO MEFs were grown in DMEM supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2019Quote: ... Human colon cDNA purchased from Clontech (Palo Alto, CA) was used as the template ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2021Quote: ... and human-specific GFAP marker STEM123 (TaKaRa, cat. Y40420). As general astrocyte markers GFAP (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... Normal human stomach tissue RNAs were purchased from TaKaRa Bio (Shiga ...
-
bioRxiv - Immunology 2019Quote: ... and Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2020Quote: Human induced pluripotent stem cells (iPSCs) (ChiPSC18, Takara Bioscience) were reprogrammed using a protocol for midbrain dopaminergic neurons adapted from Kirkeby et ...
-
bioRxiv - Cell Biology 2020Quote: Human telomerase-immortalized retinal-pigmented epithelial cells (RPE1; Clontech) either expressing LifeAct-GFP or parental (Vignaud et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... human CCDC22 was first cloned into pEGFP-C1 (Clontech) between Sal1 and BamH1 ...
-
bioRxiv - Microbiology 2023Quote: ... and the Mate and Plate Universal Human Library (Clontech). This yeast two-hybrid universal library was constructed from human cDNA that has been normalized to remove high copy number cDNAs (overrepresented transcripts ...
-
bioRxiv - Genetics 2023Quote: ... Human KISS1 was cloned into pLVX-neo vector (Clontech) for overexpression ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human iPSC line ChiPSC22 (Cellartis/Takara Bio Europe AB) was cultivated in the feeder-free DEF-CS system (Cellartis/Takara Bio Europe ...
-
bioRxiv - Plant Biology 2020Quote: ... All of the other genes encoding candidate RBOHD-associated proteins were cloned into epiGreenB5 by the same strategy using an In-Fusion HD Cloning Kit (Clontech, USA). To generate epiGreenB-pPB1CP::PB1CP-3-eGFP for transient expression in N ...
-
bioRxiv - Microbiology 2020Quote: ... Ad5 stocks were tittered by detection of the Ad hexon protein using Adeno-X™ Rapid Titer Kit (Cat. No. 632250, Takara, Clontech). The Ad5 CPE was dose-dependent ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected with plasmids expressing either SARS-COV-2 S protein WT or mutants (E1182K, L1193G, E1182K/L1193G, L1182K/L1186G/L1193G) by using Calcium phosphate transfection kit (Takara-Bio). 24 h post transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... genes were cloned into a His-SUMO fusion protein expression vector (Kim et al, 2018) using an In-Fusion Cloning Kit (639648, Takara Bio). The glycine-arginine-proline (GRP ...
-
bioRxiv - Molecular Biology 2020Quote: ... JEG3 cells (human; sex: female, placenta epithelial), HEK293 derivative Lenti-X™ 293T cells (human; sex: female, kidney epithelial) obtained from Takara (cat. 632180), Huh-7.5 heptoma cells (human ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: Human CaMKII-α (Uniprot_ID: Q9UQM7) and human CaMKII-β (Uniprot_ID: Q13554) were cloned into the pEGFP-C1 vector backbone (Clontech, Mountain View, CA), after modifying the vector to contain a biotinylation sequence (Avitag ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins were tagged with Gfp (enhanced green fluorescent protein; Clontech, Mountain View, CA, USA) at their N-terminus unless noted otherwise ...
-
bioRxiv - Immunology 2021Quote: ... pMD2.G and the CAR-expression plasmid by calcium phosphate transfection (Clontech). At 16 hrs post-transfection cells were washed with PBS and incubated in complete DMEM media containing 6 mM sodium butyrate (Sigma Aldrich) ...
-
bioRxiv - Cancer Biology 2021Quote: ... using Takara’s Lenti-X (VSV-G) Packing Single Shots (Takara Bio/ Clontech Laboratories ...
-
bioRxiv - Microbiology 2023Quote: ... and pMD2.G plasmids using TransIT-293 Transfection Reagent (TaKaRa, Cat# V2700) in Opti-MEM I Reduced Serum Medium (Thermo Fisher Scientific ...