Labshake search
Citations for Takara Bio :
251 - 300 of 5491 citations for Human Cytochrome P450 Family 4 Subfamily F Member 2 CYP4F2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... Control RNA was either Universal Human RNA (UHR) (Takara 636538) or control RNA provided in the SMART-Seq v4 kit ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... the cDNA from pooled human tissues was purchased from Takara Bio Inc ...
-
bioRxiv - Cell Biology 2021Quote: ... The Human Mitochondrial DNA Monitoring Primer Set (TaKaRa, Cat # 7246) was used to determine mitochondrial DNA (mtDNA ...
-
bioRxiv - Neuroscience 2020Quote: ... Control RNA was either Universal Human RNA (UHR) (Takara 636538) or control RNA provided in the SMART-Seq v4 kit ...
-
bioRxiv - Immunology 2022Quote: ... RetroNectin® Recombinant Human Fibronectin Fragment (Takara Bio, Cat#T100A), Recombinant Murine Flt3-Ligand (Peprotech ...
-
bioRxiv - Microbiology 2022Quote: Human liver cDNA library was obtained from Clontech (California, USA). Dual Luciferase reporter assay kit and CellTiter96 Aqueous one solution cell proliferation assay kits were from Promega (Madison ...
-
bioRxiv - Neuroscience 2022Quote: ... Control RNA was either Universal Human RNA (UHR) (Takara 636538) or control RNA provided in the SMART-Seq v4 kit ...
-
bioRxiv - Neuroscience 2023Quote: Five ug of total RNA from human total brain (Clontech) was reverse transcribed using GeneRacer oligo-dT primer and SuperScript III First-Strand Synthesis System (Life Technologies) ...
-
bioRxiv - Cell Biology 2023Quote: ... Human FCHO1 was cloned into pEGFPC1 (Clontech, Mountain View, CA). All constructs were sequence verified prior to use.
-
bioRxiv - Microbiology 2023Quote: Human kidney-derived Lenti-X 293T cells (TaKaRa, Cat# Z2180N) and porcine kidney-derived PK-15 cells (Japanese Collection of Research Bioresources Cell Bank ...
-
bioRxiv - Cell Biology 2023Quote: Human bone marrow mesenchymal stem cells (BM MSCs) (TaKaRa Bio) were cultured in Mesenchymal Stem Cell Growth Medium 2 (TaKaRa Bio ...
-
bioRxiv - Microbiology 2023Quote: ... Human embryonic kidney Lenti-X™ 293T cells (TAKARA, 632180) used for lentiviral packaging and HEK293T cells (ATCC ...
-
bioRxiv - Cell Biology 2023Quote: Diploid human retinal pigment epithelium hTERT-RPE 1 cells (Clontech) were grown in DMEM/F-12 (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: ... Human embryonic kidney (HEK) cell lines (Lenti-X 293T) (Takara) were cultured in high-glucose DMEM (Gibco ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Microbiology 2022Quote: ... Virus production was quantified by determining the amount of the Gag p24 protein using an enzyme-linked immunosorbent (ELISA) assay (Innogenetics or TaKaRa). For production of HIV-1 Env-pseudotyped viruses in Jurkat cells ...
-
bioRxiv - Molecular Biology 2021Quote: Secretion in PIP in NHLFs treated with MRG-201 or MRG-229 was conducted by collecting the supernatant of treated cells and performing procollagen type I PIP ELISA (Takara).
-
bioRxiv - Genomics 2020Quote: ... and the resulting DNase I-treated RNA (~2 ng) was processed for sequencing by using a SMART-Seq v4 Ultra Low Input RNA kit (Takara Bio) according to the manufacturer’s protocol with 12 cycles of PCR followed by two rounds of clean up with 1.3X Agencourt AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Genomics 2021Quote: ... were used for library construction using the SMARTer Stranded Total RNA-Seq Kit v.2 (634418, Pico Input Mammalian, Takara/Clontech, Japan) according to the manufacturer’s protocol without RNA fragmentation ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were transfected with plasmids expressing either SARS-COV-2 S protein WT or mutants (E1182K, L1193G, E1182K/L1193G, L1182K/L1186G/L1193G) by using Calcium phosphate transfection kit (Takara-Bio). 24 h post transfection ...
-
bioRxiv - Microbiology 2021Quote: ... Then PCR application using specific primer pairs (Supplemental Table 2) designed for H7N9 virus and Takara One-step RT-PCR kit (Takara, China) segment by segment ...
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2019Quote: ... The pure linearized vector and the elpc-2 promoter were fused using an In-Fusion HD Cloning Kit (Takara, Kusatsu, Japan) to make the elpc-2p::GFP transcriptional reporter construct ...
-
bioRxiv - Immunology 2021Quote: ... was used to clone SARS-CoV-2 S gene into the SFG backbone using the In-Fusion Cloning kit (Takara Bio). pSFG-SARS-CoV-2 S D614G was cloned from pSFG-SARS-CoV-2 S plasmid using the Q5 Site-Directed Mutagenesis Kit (New England BioLabs) ...
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2020Quote: ... Double-strand cDNA was amplified by long-distance PCR (LD-PCR) using an Advantage 2 PCR kit (Clontech, cat. no. 639206).
-
bioRxiv - Neuroscience 2023Quote: ... Total RNA (1–2 µg) was reverse transcribed using random hexamers and the PrimeScript™ 1st strand cDNA Synthesis Kit (TaKaRa). RT-qPCR was performed using a StepOnePlus qPCR system (Applied Biosystems ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2 mM dithiothreitol (Clontech), 2 μM template switching oligo (Exiqon) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 (Takara, Shiga, Japan) and 0.32 µM of each primer according to the manufacturer’s instructions ...
-
bioRxiv - Systems Biology 2020Quote: ... full length double stranded cDNA (dscDNA) was generated using the SMART-Seq version 4 Ultra Low Input kit (Takara Bio USA, Mountain View, CA) and the Nextera XT DNA Library Preparation kit (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Section B step 4 in the protocol was modified to account for the incorporation of UDIs (Takara SMARTer RNA Unique Dual Index Kit-96A). A total of 2 uL of each UDI was used instead of the recommended 1 uL each of the 5’ and 3’ PCR primers ...
-
bioRxiv - Genomics 2021Quote: ... 4 ul 2.5 μM dNTP mixture (Takara), 0.8 ul 100mM DTT and 14.2 ul RNase-free water ...
-
bioRxiv - Microbiology 2022Quote: ... and 4 μM random hexamer primers (Takara Bio ...
-
bioRxiv - Microbiology 2020Quote: ... and 4) TaKaRa LA Taq (TaKaRa RR042). For each library ...
-
bioRxiv - Cell Biology 2023Quote: ... The human WT Trop-2 and the Trop-2-Q118E mutant cDNAs [70] were amplified by PCR method (primers: F’ gcgattctcgagtccggtccgcgttcc-XhoI and R’ gcgccggtaccaagctcggttcctttc-KpnI) and sub-cloned into the pEYFP-N1 vector (Clontech, OH, USA) for mammalian expression to give the Trop-2-pEYFP-N1 and Trop-2-Q118E-pEYFP-N1 plasmids.
-
The spindle protein CKAP2 regulates microtubule dynamics and ensures faithful chromosome segregationbioRxiv - Cell Biology 2023Quote: ... pEF1α-TET3G-stable cell lines were then transfected with a pTRE3G-CKAP2:mGL plasmid containing the PTRE3G promoter activatable upon doxycycline exposure and cultured in regular DMEM/F-12 media supplemented with Tet-Approved FBS free of tetracycline contaminants (Takara Bio; 631105). Prior to experiments ...
-
bioRxiv - Bioengineering 2023Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and cotransfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Genomics 2021Quote: ... were used for library construction using the SMARTer Stranded Total RNA-Seq Kit v.2 (634418, Pico Input Mammalian, Takara/Clontech, Japan) according to the manufacturer’s protocol without RNA fragmentation ...
-
bioRxiv - Synthetic Biology 2021Quote: ... The amplified fragments were cloned into a modified pET16b expression vector (Table 2) by using In-Fusion cloning kit (Takara, Shiga, Japan). The sequence of the inserts of the resulting plasmids was verified by Sanger sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... cDNA was prepared from 2 µg of each RNA sample using the PrimeScript II 1st strand cDNA synthesis kit (TaKaRa, Shiga, Japan) with 40 units of RNasin Plus RNase inhibitor (Promega ...
-
bioRxiv - Genetics 2020Quote: ... First-round reverse transcription PCR (RT-PCR) was conducted by using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa, Dalian, China). A 10 μL reaction mixture contained 5 μL of 2 × 1 Step Buffer ...
-
bioRxiv - Immunology 2021Quote: Retroviral SARS-CoV-2 Spike pseudovirus were generated in 293T cells by co-transfecting expression plasmids containing SARS-CoV-2 Spike and MLV gag/pol and luciferase vectors using Calphos transfection kit (Takara Bio, USA) as described [20] ...
-
bioRxiv - Cancer Biology 2022Quote: ... For reverse transcription 2 µg RNA were translated into cDNA using the “RNA to cDNA EcoDry” Kit (Takara Bio USA, Kusatsu, Japan) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Genetics 2023Quote: ... RNA from 2 retinae of a mouse was extracted using the NucleoSpin® RNA kits (Takara Bio USA, Inc., San Jose, CA). RNA sample concentration and quality was determined with NanoDrop Oneᶜ Microvolume UV-Vis Spectrophotometers (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... cDNA library was generated from 2 nanograms of total RNA using Smart-Seq V4 Ultra Low Input RNA Kit (Takara catalog#: 634894). 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog# ...
-
bioRxiv - Neuroscience 2021Quote: ... anti-human GFAP (mouse IgG1, 1:2000, Takara Bio, Shiga, Japan), anti-CNPase (mouse IgG1 ...