Labshake search
Citations for Takara Bio :
101 - 150 of 5309 citations for Human Adrenomedullin 2 ADM2 CLIA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Human embryonic kidney 293T (HEK293T/HEK293LE; Clontech 632180) cells were cultured in DMEM with 10% fetal bovine serum (Fisher #10082-147 ...
-
bioRxiv - Genetics 2023Quote: Human embryonic kidney cells (HEK293T, Takara Bio #632180)) were cultured in DMEM-GlutaMAX media (10566024 ...
-
bioRxiv - Neuroscience 2024Quote: Human embryonic kidney 293T cells (#632273, Takara Bio) were used to produce AAVs ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Specific primers were designed for this purpose and PCR was done using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to each target sequence on all Mycoplasmas species genome used in this study ...
-
bioRxiv - Cell Biology 2023Quote: ... and N-SREBP2 (1440 bps) were amplified using high-fidelity PCR (Advantage-HF 2 PCR kit, #639123; Clontech) from human pcDNA3.1-2xFLAG-SREBP1a (#26801 ...
-
bioRxiv - Cell Biology 2023Quote: ... The virus titer was quantified using the AAVpro Titration Kit (for Real Time PCR) Ver.2 (Takara Bio) according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: The cDNA coding sequences of the first and second cytoplasmic loop domain of human TMEM39A were cloned into the pGBKT7 vector and screened against a normalized universal human cDNA library (Clontech, 630481), following instruction of the Matchmaker® Gold Yeast Two-Hybrid System (Clontech ...
-
bioRxiv - Genetics 2020Quote: The cDNA coding sequence of the C-terminal domain of human TMEM132D was cloned into the pGBKT7 vector and screened with a normalized universal human cDNA library (Clontech, 630481) in pGADT7 Vector ...
-
bioRxiv - Cancer Biology 2023Quote: Lentiviral vectors for expression of LDHA or LDHB were generated by PCR amplification of the respective cDNAs from plasmids obtained from the Eugene McDermott Center for Human Growth and Development Sequencing Core Human ORF Collection and cloning into pLVX-IRES-Puro (Takara 632183) through Gibson assembly (NEB E2621) ...
-
bioRxiv - Cell Biology 2023Quote: ... and of human FAM104B isoform 3 (NM_001166700.2) were PCR- amplified from a yeast two-hybrid human testis cDNA library (Clontech, cat. no. 638810) and cloned via appropriate restriction sites into pGAD-C1 (James et al ...
-
bioRxiv - Molecular Biology 2021Quote: ... Methylated and non-methylated DNA fragments were separated using the EpiXplore Methylated DNA Enrichment Kit (Clontech, cat# PT5034-2). Libraries were generated using the DNA SMART ChIP-Seq Kit (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... Approximately 2 μg of total RNA was reverse-transcribed using PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Real-time quantitative RT-PCR was performed with TB Green Premix Ex Taq™ (TakaRa ...
-
bioRxiv - Cell Biology 2021Quote: ... HUVECs were maintained in Endothelial Cell Basal Medium 2 supplemented with Endothelial Cell Growth Medium kits (C22211, C22111, Takara). For replating cells ...
-
bioRxiv - Immunology 2020Quote: ... and a primer (1μM final concentration) binding to the introduced SMARTER oligonucleotide (CTAATACGACTCACTATAGGGC) using the Advantage 2 PCR kit (Clontech) in a 50μl reaction ...
-
bioRxiv - Bioengineering 2022Quote: ... RNA (2 µg) was reverse transcribed into cDNA with the RT Reagent Kit with gDNA Eraser (Takara, Japan, RR047A). qPCR was performed using a SYBR Premix Ex Taq kit (Takara ...
-
bioRxiv - Microbiology 2023Quote: ... or Omicron variant (G339D) using a SARS- CoV-2 Direct Detection RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) with each specific primer/probe ...
-
bioRxiv - Molecular Biology 2022Quote: ... one subjected to RT-PCR using PrimeScript™ One Step RT-PCR Kit Ver.2 (Dye Plus) (Takara, Japan), then the region between S-5’UTR and N protein-ORF genes was amplified to monitor the expression of eGFP.
-
bioRxiv - Molecular Biology 2023Quote: ... and then used as the template to synthesize double strand cDNA amplicons by PCR (optimal 17 – 21 cycles) using Advantage 2 PCR kit according to the manufacturer’s specifications (Clontech). cDNA was purified using NucleoSpin Gel and PCR Clean-up kit (Takara Bio) ...
-
bioRxiv - Cancer Biology 2020Quote: ... Human total RNA from different normal tissues from Clontech (Human Total RNA Master Panel II,Cat# ...
-
bioRxiv - Cell Biology 2019Quote: ... and human BaxS184V was cloned in pEGFP-C1 (Clontech). Bax/Bak DKO MEFs were grown in DMEM supplemented with 10% FBS ...
-
bioRxiv - Biochemistry 2019Quote: ... Human colon cDNA purchased from Clontech (Palo Alto, CA) was used as the template ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Developmental Biology 2021Quote: ... and human-specific GFAP marker STEM123 (TaKaRa, cat. Y40420). As general astrocyte markers GFAP (DAKO ...
-
bioRxiv - Cancer Biology 2021Quote: ... Normal human stomach tissue RNAs were purchased from TaKaRa Bio (Shiga ...
-
bioRxiv - Immunology 2019Quote: ... and Retronectin (Recombinant Human Fibronectin) was purchased from Takara Bio (Saint-Germain-en-Laye ...
-
bioRxiv - Neuroscience 2020Quote: Human induced pluripotent stem cells (iPSCs) (ChiPSC18, Takara Bioscience) were reprogrammed using a protocol for midbrain dopaminergic neurons adapted from Kirkeby et ...
-
bioRxiv - Cell Biology 2020Quote: Human telomerase-immortalized retinal-pigmented epithelial cells (RPE1; Clontech) either expressing LifeAct-GFP or parental (Vignaud et al. ...
-
bioRxiv - Biochemistry 2022Quote: ... human CCDC22 was first cloned into pEGFP-C1 (Clontech) between Sal1 and BamH1 ...
-
bioRxiv - Microbiology 2023Quote: ... and the Mate and Plate Universal Human Library (Clontech). This yeast two-hybrid universal library was constructed from human cDNA that has been normalized to remove high copy number cDNAs (overrepresented transcripts ...
-
bioRxiv - Genetics 2023Quote: ... Human KISS1 was cloned into pLVX-neo vector (Clontech) for overexpression ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Cancer Biology 2023Quote: ... Human iPSC line ChiPSC22 (Cellartis/Takara Bio Europe AB) was cultivated in the feeder-free DEF-CS system (Cellartis/Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 (Takara, #6045) according to manufacturer’s protocols ...
-
bioRxiv - Immunology 2022Quote: ... version 2 (Takara). Fastq files were generated from bcl files using BCL2FASTQ v2.17.1.14 with default parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 (Takara Bio).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (Takara Bio).
-
bioRxiv - Molecular Biology 2020Quote: ... JEG3 cells (human; sex: female, placenta epithelial), HEK293 derivative Lenti-X™ 293T cells (human; sex: female, kidney epithelial) obtained from Takara (cat. 632180), Huh-7.5 heptoma cells (human ...
-
Flexible linkers in CaMKII control the balance between activating and inhibitory autophosphorylationbioRxiv - Biophysics 2019Quote: Human CaMKII-α (Uniprot_ID: Q9UQM7) and human CaMKII-β (Uniprot_ID: Q13554) were cloned into the pEGFP-C1 vector backbone (Clontech, Mountain View, CA), after modifying the vector to contain a biotinylation sequence (Avitag ...
-
bioRxiv - Genomics 2020Quote: ... PCRs were performed on board using 25 ng of DNA from each coral sample with the Advantage 2 kit (Takara Clontech) and a final primer concentration of 0.5 μM in a final reaction volume of 50 μl ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNA copy number was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). Fluorescent signals were acquired using QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2022Quote: ... and 2 ng of total RNA was amplified with SMART-Seq v4 Ultra Low Input RNA kit (Clontech; version “091817”). Sequencing libraries were prepared with NEBnext Ultra DNA Library Prep Kit (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... SARS-CoV-2 RNA quantification was performed by RT-qPCR targeting the S gene of SARS-CoV-2 using One Step PrimeScript RT-PCR Kit (Takara) with the following SARS-CoV-2 specific primers and probes ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 µg of RNA was used for the preparation of cDNA using PrimeScript Reagent Kit with gDNA eraser (Takara, Japan). Signal detection ...
-
bioRxiv - Zoology 2019Quote: ... were obtained from the mRho.V5.mER.hOr47a construct via PCR using the Advantage 2 PCR kit (Cat. Nr. 639206, Takara, Kusatsu, Japan) using the E.hOr47a_fwd and hOr47a_fwd forward primers ...
-
bioRxiv - Cancer Biology 2020Quote: ... Both CnAOEC and ISO-HAS-B were cultured in Endothelial Cell Growth Medium 2 Kit (Takara Bio, Inc. Kusatsu, Japan). All cells used were routinely tested for Mycoplasma using PCR and were submitted to ICLAS Monitoring Center (Kawasaki ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated from 2 ng total RNA using the SMART-Seq v4 Ultra Low Input RNA Kit (Clontech Laboratories) and amplified using 11 cycles of PCR ...
-
bioRxiv - Microbiology 2022Quote: ... and E484Q mutations of the SARS-CoV-2 spike protein were determined by qPCR using mutation detection kits purchased from Takara Bio (Shiga ...