Labshake search
Citations for Takara Bio :
201 - 250 of 269 citations for Hepatitis B Virus E Antigen HBeAg since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The cells were grown for 72 hours post-transfection and the virus was concentrated ∼40-fold from the supernatant using the Lenti-X concentrator kit (Takara) per the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: Media was collected 48 h after transfection and clarified by syringe filtration through a 0.45 µm polyvinylidene difluoride membrane (Millex-HV) before concentrating the virus with a Lenti-X concentrator (Clontech 631231). The concentrated virus was resuspended in PBS and aliquoted into single-use tubes stored at −80 °C ...
-
bioRxiv - Cell Biology 2023Quote: Paraffin sections were used for H/E staining and ALP staining with a commercial staining kit (TaKaRa, TRACP & ALP double-stain kit ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adeno-associated virus pseudotype 6 (AAV6) expression vector encoding ARP5 was constructed using AAVpro Helper Free System (AAV6) (TAKARA BIO). Finally ...
-
bioRxiv - Neuroscience 2021Quote: ... The single strand cDNA for 5’RACE was prepared by in vitro reverse transcription with avian myeloblastosis virus reverse transcriptase XL (Takara Bio) using total RNA (0.5 µg ...
-
bioRxiv - Microbiology 2021Quote: ... Then PCR application using specific primer pairs (Supplemental Table 2) designed for H7N9 virus and Takara One-step RT-PCR kit (Takara, China) segment by segment ...
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Plant Biology 2020Quote: ... plant intron Syn7 [34] regulated by a double-enhancer Cauliflower mosaic virus 35S RNA promoter (P35S2) and a nos terminator in the T-DNA binary vector pBI121 (Clontech, Switzerland). Syn7 was amplified with the primers 5′- GAGCTGAAAGggtaagattatcgatatttaaattatttatttcttcttttc-3′ and 5′-TGAAGTCGATGCctgcatgatatcataaaaccatgga-3′ specifying the splicing junctions and then inserted into the YFP coding region by overlapping PCR ...
-
bioRxiv - Microbiology 2021Quote: Viral RNA was extracted directly from the virus stock using the Indimag Pathogen kit (Indical Biosciences) and transcribed to cDNA using the PrimeScript™ RT reagent Kit (Takara) using oligo-dT and random hexamers ...
-
bioRxiv - Cell Biology 2022Quote: ... Three days post transduction virus-containing supernatants were harvested and concentrated approximately 40-fold using Lenti-X Concentrator (Clontech; Mountainview, CA). Concentrated viruses were frozen and stored at −80°C until needed ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from the cells reserved from compound treatment and virus infection experiments using RNAiso Plus reagent (TaKaRa, Japan) to analyze gene expression by quantitative PCR ...
-
bioRxiv - Immunology 2022Quote: ... Retroviral vectors were packaged into VSV G–pseudotyped murine leukemia virus (MLV) particles by co-transfecting GP2-293 cells (Clontech Laboratories) with pQCXIP constructs and pVSV-G (Clontech Laboratories) ...
-
bioRxiv - Cancer Biology 2023Quote: Production of vesicular stomatitis virus (VSV-G) pseudotyped lentivirus was performed by calcium phosphate transfection of Lenti-XTM 293T cells (TaKaRa Clontech, 632180) with CROP-mCherry and helper plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260) ...
-
bioRxiv - Microbiology 2023Quote: ... A parallel virus production was obtained by substitution of the ISG20 coding viral genome with pRetroX-Tet-On (Clontech, cat. 632104) that codes for the TetOn protein and allows for dox ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Microbiology 2020Quote: ... RNAs extracted from 100 µl of virus-containing supernatants or PBMCs were amplified by using a PrimeScript® RT reagent Kit (Perfect Real Time) (Takara Bio) and 5’RACE was performed by using a 5’RACE System for Rapid Amplification of cDNA Ends ...
-
bioRxiv - Neuroscience 2021Quote: ... After the immortalization procedure the absence of virus was verified using the Lenti-X p24 Rapid Titer Kit (Takara Bio USA, #632200).
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was collected after 24 hours for 3 consecutive days and concentrated with Lenti-X Concentrator (Takara Bio USA, Mountain View, CA). A mixture of two shRNA constructs for SPCA2 was used ...
-
bioRxiv - Cancer Biology 2023Quote: Production of vesicular stomatitis virus (VSV-G) pseudotyped lentivirus was performed by calcium phosphate transfection of Lenti-XTM 293T cells (TaKaRa Clontech, 632180) with CROP-mCherry and helper plasmids pMD2.G and psPAX2 (Addgene plasmids 12259 and 12260) ...
-
bioRxiv - Microbiology 2023Quote: Standards for determining copy number of virus stock were prepared using the PrimeScript II High Fidelity One Step RT-PCR Kit (TaKaRa, Cat# R026A) with IAV (H1N1 ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... hygromycin B (300 µg/ml) and 10% tetracycline free fetal bovine serum (Takara Bio, USA) in a humidified incubator at 37°C in 5% CO2 in 6-well plates ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Molecular Biology 2022Quote: ... the 5′ and 3′’ untranslated regions (UTRs) of the virus were determined using a SMARTer®RACE 5′/3′ Kit (Takara Bio, USA). Viral RNA isolated in August ...
-
bioRxiv - Biophysics 2022Quote: ... containing virus was collected after 48 hrs and concentrated by 50-fold following the protocol of Lenti-X™ Concentrator (Takara, Cat. #: 631232). The concentrated virus in 40uL volume was added to HEK293T cells plated several hours ahead started with 80,000 cells in one well of a 24-well plate ...
-
bioRxiv - Bioengineering 2023Quote: ... CCR5-KO donor rAAV6 virus was produced in HEK-293T cells and was purified with AAVpro Purification Kit (TakaRa, San Jose, CA, USA). Electroporation of the RNP complex was performed using the Lonza 4D-Nucleofector (Lonza Group Ltd ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5 μg of total RNAs were reverse-transcribed into cDNA at 42°C for 1 h in 20 μl reaction mixture containing mouse Moloney leukemia virus reverse transcriptase (PrimeScript, TAKARA BIO, Shiga, Japan) with random 6 primers (TAKARA BIO) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TCR beta chain libraries were generated using SMARTer Mouse TCR a/b Profiling Kit (Clontech). Samples were pooled to a final pool concentration of 4 nM and diluted to a final concentration of 13.5 pM ...
-
bioRxiv - Cell Biology 2021Quote: ... pBos-CENP-B-GFP was constructed by replacing the H2B fragment in pBos-H2B-GFP (Clontech) with the KpnI/BamHI-digested PCR fragments encoding the centromere-targeting domain (residues 1-163 ...
-
bioRxiv - Cancer Biology 2023Quote: PDGF-IRES-Cre was generated by cloning human PDGF-B and Cre into pQXIX vector (Clontech) as previously described5 ...
-
bioRxiv - Microbiology 2021Quote: ... the pLVX-ORF3-E plasmid was transfected into HEK-293T cells using the Lenti-X Packaging Single Shots kit (Takara). Lentiviral supernatants were harvested at 72 h post-transfection and filtered through a 0.22 μM membrane (Millipore ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus particles were collected 24 hours and 48 hours after transfection and concentrated with Lenti-X™ Concentrator (Takara, California, USA, Cat#631232). The pellets were then resuspended with PBS ...
-
bioRxiv - Immunology 2022Quote: ... Bulk TCR sequencing was performed using the SMARTer® Mouse TCR a/b Profiling Kit (Takara Bio). Libraries were sequenced using the 600-cycle MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2024Quote: For immunostaining the following antibodies were used: mouse anti-E-cadherin mAb clones SHE78-7 and HECD1 (Takara, M126 and M106), mouse anti-vinculin (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed to insert these linear fragments into the pMV306 previously digested with EcoRV and transformed into Escherichia coli (E. coli) Stellar TM competent cells (Takara Bio), purified (NucleoSpin Plasmid ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... DNA was purified using the standard phenol-chloroform extract method and subjected to DNase I (Takara, 2270 B) treatment and reverse transcription for DRIPc-seq library construction ...
-
bioRxiv - Developmental Biology 2021Quote: ... was inserted in a Tol2 vector containing the hsp70l:xxxp2a-TFP sequence (kind gift from Prof. B. Martin, Stony Brooks University, NY) by In Fusion (Clontech) cloning ...
-
bioRxiv - Biochemistry 2020Quote: ... Amplified genes were cloned into an altered pFastBacHT B vector using the In-Fusion HD EcoDry Cloning Kit (Clontech). After transformation of DH10EMBacY E ...
-
bioRxiv - Genomics 2021Quote: ... coli HST08 (used to test coregulation of genes in newly-formed operons and for vector construction; E. coli HST08 Premium Competent Cells, Takara Bio, Japan, 9128).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 N and E genes were transcribed from the pBluescript-N and pUC57-E plasmids by adding a T7 promoter via PCR using Premix Taq (Cat. No. R004A, TAKARA, Shuzo, Shiga, Japan). The crRNA templates were amplified from a pUC57-T7-crRNA (Supplementary Table S10 ...
-
bioRxiv - Immunology 2019Quote: ... Transduction of PBMCs with LV-GXM-CAR constructs was performed using RetroNectin reagent (Takara Bio USA; cat. no. T100A/B) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Amplicons were gel-purified and ligated into a pOPIN-B vector digested with HindIII and KpnI using In-Fusion technology (Clontech). The primer sequences in low case correspond to adaptors pairing with the linearized vector ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...