Labshake search
Citations for Takara Bio :
351 - 400 of 486 citations for HCC 4 CCL16 Human CHO since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Viruses were packaged in human embryonic kidney (HEK) 293 cells and viral supernatants were processed using Retro-X concentrators (Takara Bio. USA Inc). Naïve CD8 T cells were purified by negative-selection and stimulated in vitro with plate-bound anti- CD3/CD28 ...
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Cell Biology 2022Quote: Mouse NIH/3T3 (ATCC, cat# CRL-1658), human IMR-90 (ATCC, cat# CCL-186) and Lenti-X™ 293T (Takara Bio, cat# 632180) cell lines were cultured in full-DMEM (Corning ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic stem cell (hESC)-derived cerebral organoids (hCOs) were generated from a commercially available hESC stem cell line (Takara Bio, Osaka, Japan), using the STEMdiff cerebral organoid kit (STEMCELL Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the membrane was incubated overnight at 4°C with an anti-GFP monoclonal primary (JL-8; Clontech 632381) at 1:5,000 dilution ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Genetics 2019Quote: ... following 0.5 mM IPTG induction for 4 h at 25°C with subsequent purification using TALON chromatography (Clontech) as described 34 ...
-
bioRxiv - Microbiology 2021Quote: ... and 10 ng of Renilla luciferase (pTK r.luc) by using 4 µl of TransIT 293 (Takara, Shiga, Japan) and 100 µl of OPTI- MEM (Thermo Fisher Scientific ...
-
bioRxiv - Plant Biology 2020Quote: ... which contained 4 µL of lysis buffer with 1 U/µL of Recombinant RNase Inhibitor (RRI, Clontech 2313B), 0.1% [w/v] Triton X-100 (Thermo Scientific 85111) ...
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Immunology 2019Quote: ... using the manufacturers protocol and amplified using SMARTer Ultra Low Input RNA kit for sequencing (version 4, Clontech). Sequencing libraries were generated using TruSeq Nano DNA Sample Preparation kits (Illumina) ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Genomics 2020Quote: Lysis plates were prepared by dispensing 0.3μL lysis buffer (4 U Recombinant RNase Inhibitor (RRI) (Takara Bio, 2313B), 0.12% Triton™ X-100 (Sigma ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Plant Biology 2023Quote: ... 4 μg of total RNA was used for cDNA synthesis with PrimeScript 1st strand cDNA Synthesis Kit (Takara), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Developmental Biology 2021Quote: ... was incubated with antibodies at 4°C for one hour: 3 µl (0.5 µg/µl) c-Myc monoclonal antibody (Cat. No. 631206, TaKaRa), or 1 µl (1.1 µg/µl ...
-
bioRxiv - Neuroscience 2020Quote: ... before addition of 4 mM imidazole and incubation on a rotor (111 RPM) with TALON metal affinity resin (Takara, Cat.# 635503 ...
-
bioRxiv - Biochemistry 2021Quote: ... The cell lysate was centrifuged at 40,000 × g for 45 min at 4 °C and the supernatant was loaded onto a cobalt affinity column (Clontech). After washing the column with 20 bed volume of 20 mM HEPES pH 7.5 ...
-
bioRxiv - Biochemistry 2021Quote: ... The lysate was clarified at 26,915 x g for 50 minutes at 4°C and then incubated with TALON metal affinity resin (Clontech). His-Nsp15 was eluted from the resin with 250 mM imidazole ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μL of 10 × PCR Buffer (Mg2+ plus) provided with the TAKARA Taq™ Hot Start Version (TAKARA, Japan), 0.08 μL of TransScript® Reverse Transcriptase [M-MLV ...
-
bioRxiv - Biophysics 2022Quote: ... The supernatant was clarified by centrifugation (292,055 g, 60 min, 4°C) and bound to 2 ml of TALON IMAC resin (Clontech) overnight with 10 rpm rotation in the presence of 20 mM imidazole and NaCl added up to 800 mM ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Biochemistry 2020Quote: ... The lysate was clarified at 26,915 × g for 50 minutes at 4°C and then incubated with TALON metal affinity resin (Clontech). His-Thrombin-TEV-Nsp15 variants were eluted with 250 mM imidazole and further purified by gel filtration on a Superdex-200 column (GE Healthcare ...
-
bioRxiv - Biophysics 2021Quote: ... The resulting supernatant was collected by ultracentrifugation (150,000 × g, 1 hour, 4 °C) and applied onto an immobilized metal-ion affinity chromatography column (Talon, Clontech) equilibrated with 40 mM Tris ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Immunology 2020Quote: ... non-tissue culture treated 96-well plates were coated overnight at 4 °C with 1 ml of retronectin (Takara) at 25μg/ml in PBS ...
-
bioRxiv - Pathology 2023Quote: ... Cells were harvested by centrifugation at 4,000 rpm for 20 min at 4℃ and resuspended in 20 ml xTractor buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Pathology 2023Quote: ... Cells were harvested by centrifugation at 4,000 rpm for 20 min at 4℃ and resuspended in 20 ml xTractor buffer (Clontech, TaKaRa Biomedical Technology [Beijing] Co. ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...
-
bioRxiv - Systems Biology 2022Quote: ... The blocked membrane was incubated overnight at 4 ℃ in primary antibodies: mouse polyclonal anti-Cas9 (Takara Bio, cat. no. 632607), mouse monoclonal anti-β-actin (8H10D10 ...
-
bioRxiv - Genomics 2019Quote: ... into individual wells of a 48-well plate (Brand) filled with 4 μl of a hypotonic lysis buffer containing 2 U/μL RNase inhibitor (Takara) and 0.2 % Triton-X-100 in Nuclease-free water ...
-
bioRxiv - Neuroscience 2019Quote: ... RNA-seq library was generated using the SMART-seq v.4 Ultra Low Input RNA Kit (Takara Bio, Kusatsu, Japan) and Nextera XT DNA Library Prep Kit (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... Same volume of samples were loaded on 4-16% gradient SDS-PAGE gels and analyzed by western blot analysis using EGFP (JL-8; Clontech), penta-HIS (QIAGEN ...
-
bioRxiv - Molecular Biology 2020Quote: ... RNA was annealed to primers by the addition of 4 µL 100 µM Random Hexamer Primers (TaKaRa, Mountain View, CA) and incubation at 65°C for 5 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... The libraries for RNA sequencing were generated using SMART-Seq v.4 Ultra Low Input RNA (Takara Bio, cat. #634890) and Nextera XT DNA Library Prep Kit (Illumina ...