Labshake search
Citations for Takara Bio :
151 - 200 of 1042 citations for Glyphosate Chemical Purity 96% 2 13C 99%; 15N 98+% 100 Ug Ml In H2O since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... Ver.2 (Takara, cat# 6233), as per manufacturer’s protocol.
-
bioRxiv - Neuroscience 2021Quote: ... qPCR was performed using Roche LightCycler 96 System with TB Green Premix Ex Taq II (Takara), in triplicate for each sample on 96-well plate ...
-
bioRxiv - Neuroscience 2023Quote: ... GP2-293 cells were cultured in DMEM (FUJIFILM Wako Pure Chemical) supplemented with 10% tetracycline-free FBS (Takara Bio).
-
bioRxiv - Developmental Biology 2019Quote: ... Rabbit anti-Dsred (1:100; Takara, 632496), Mouse anti-Trio (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Rabbit anti-dsRed (1:100, Clontech, 632496), Rabbit anti-Neuroglian (1:50 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Total RNA from each candidate cell line was digested to single nucleoside using nuclease P1 (Fujifilm Wako Pure Chemical Corporation) and bacterial alkaline phosphatase (TaKaRa), followed by mass spectrometry analysis ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each well of the 96-well plate contained 3µL lysis buffer (10U Recombinant RNase Inhibitor (Takara Bio), 0.2% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Cell Biology 2020Quote: ... and virus was collected 72 and 96 hours after transfection and concentrated using Lenti-X concentrator (Clontech). Cells were then transduced with virus after growing to 75% confluency and supplemented with 10μg/mL polybrene ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Developmental Biology 2020Quote: ... Living Colors anti-DsRed (Clontech #632496, 1:100), anti-RFP (Novus Biologicals #42649) ...
-
bioRxiv - Developmental Biology 2019Quote: ... mCherry (Takara Bio or Novus Biologicals, 1:100). For Snail/Dach double immunostaining ...
-
bioRxiv - Developmental Biology 2021Quote: ... to detect mOrange (rabbit, Clontech 632496, 1:100). The polyclonal NvINSM1 antibody was raised by GenScript in rabbit against amino acids 3 – 170 of NvINSM1 expressed in and purified from E.coli ...
-
bioRxiv - Neuroscience 2021Quote: ... hNSC antibody (SC121, 1:100; Takara: Cat #: Y40410) and vGlut 1 (vesicular glutamate transporter 1 ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Physiology 2022Quote: ... NS was induced by intraperitoneal injection of 0.5 μg/g body weight of the chemical AP20187 (Takara Bio Inc. Kusatsu, Japan), in 8-10 weeks-old male transgenic mice ...
-
bioRxiv - Cell Biology 2022Quote: cDNA was generated from single cells in the 96-well plate using the SmartSeq v4 kits (Takara Bio) using 1/4th volume reactions dispensed using a Mantis dispenser (Formulatrix) ...
-
bioRxiv - Cell Biology 2022Quote: ... Viral containing supernatant was collected at 96 hr post transfection and concentrated using Lenti-X concentrator (Takara; 631232). Collected lentivirus was tittered using Lenti-X™ GoStix™ Plus (Takara;631280) ...
-
bioRxiv - Neuroscience 2023Quote: ... Quantitative PCR was performed on Thermo Piko Real 96 (Thermo) using SYBR Green PCR Master Mix (Takara #RR820A). The mRNA expression level was calculated by the 2-ΔΔCt method and the results were plotted by using tubulin as the reference gene ...
-
bioRxiv - Molecular Biology 2022Quote: ... Tagged proteins were bound to 6 (=3 mL bed volume) or 3 mL (=1.5 mL bed volume) pre-equilibrated Talon SuperFlow Metal Affinity Resin from TaKaRa (LarA wt ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg cDNA (Takara, Clonetech, USA) was prepared as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 × 106 Lenti-X 293T cells (Clontech) were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Advantage GC 2 PCR Kit (Takara) was used for gene cloning ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to the target sequence on M ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Microbiology 2020Quote: ... or Advantage 2 Polymerase mix (Takara Bio) for amplification of UTRs and Pfmyob ...
-
bioRxiv - Genomics 2019Quote: ... and an Advantage 2 PCR Kit (Clontech) were used for cDNA generation ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Developmental Biology 2023Quote: ... Advantage 2 polymerase (TaKaRa Bio, Shiga, Japan), or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µL Smartscribe Reverse Transcriptase (Takara). RNA mixtures were combined with the RT reaction mixture ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads are then subjected to three TE-TW washes and loaded into WTA PCR (100 μM Truseq PCR primer: IDT, CTACGACGCTCTTCCGATCT; 100 μM SMART PCR primer: IDT, AAGCAGTGGTATCAACGCAGAGT; Terra PCR mix: Takara Bio, 639284) with cycling conditions 98°C for 2min ...
-
bioRxiv - Molecular Biology 2021Quote: ... cultivated in mTESR1 and grown 48hrs before functionality of the suicide gene was assessed by adding the chemical inducer of dimerization (CID) (AP20187, B/B Homodimerizer, Clontech Laboratories, Inc), or AP1903 ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Neuroscience 2021Quote: ... Rapamycin analogue linker drug (AP21967, Clontech, 100 nM, 3hrs), SAR405 (Millipore Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-dsRed dilution 1:100 (IF) (Clontech, 632496); mouse anti-M6PR dilution 1:100 (IF ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Microbiology 2021Quote: ... and SmartScribe Reverse Transcriptase (TaKaRa 639538; 100 units/reaction)) were added to each of the samples (28) ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed antibody (Clontech, 632496, 1:100 dilution), Guinea pig anti-Period antibody (Gift from Amita Sehgal ...
-
bioRxiv - Genomics 2019Quote: ... 2.5-mM SMARTer Kit Dithiothreitol (100 mM; Clontech, 634936), 1-mM SMARTer Kit dNTP Mix (10 mM each ...