Labshake search
Citations for Takara Bio :
101 - 150 of 5234 citations for Glucose Colorimetric Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2021Quote: TdT-mediated dUTP nick end labeling (TUNEL) staining was carried out with In Situ Apoptosis Detection Kit (MK500, Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2022Quote: The BLV pol gene was measured in the genomic DNA samples of blood and tissue samples of cattle using real-time PCR with a BLV Detection Kit (Takara Bio, Otsu, Japan) with a LightCycler 480 System II (Roche Diagnostics ...
-
bioRxiv - Pathology 2021Quote: ... The number of SARS-COV-2 copies were quantified using Direct One-Step RT-qPCR Mix for SARS-CoV-2 kit (Takara Bio Inc.).
-
bioRxiv - Immunology 2023Quote: ... Retroviral supernatants were then collected and spun at 2,000g for 2 h at 32 °C onto 24-well non-tissue-culture-treated plates coated overnight in Retronectin (Takara Bio) or spinfected for 90 minutes at 32°C in 1 µcg mL-1 polybrene ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Activated T cells were transduced on day 1 after stimulation using combinations of PEG-precipitated retroviral concentrates encoding different constructs adsorbed onto non-tissue culture treated 6-well plates coated with anti-CD3/CD28 2 μg/mL each and retronectin 20 μg/mL (Takara, T100B) at 1-2×106 cells/well ...
-
bioRxiv - Genomics 2023Quote: ... A total of 3.5 μl ribo-depleted material was used for SMARTer (SMARTer PCR cDNA Synthesis Kit, catalog num. 634926 and Advantage 2 PCR kit, catalog num. 639207, Clontech-Takara) protocol ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl purified cDNA was amplified with an Advantage HF 2 PCR kit (Takara) in a 25 µl reaction containing 0.5 µl forward primer (10 µM ...
-
bioRxiv - Microbiology 2023Quote: ... followed by RT-PCR using PrimeScript One Step RT-PCR Kit Ver.2 (TaKaRa) with primers no ...
-
bioRxiv - Neuroscience 2022Quote: ... The titer of AAVs was measured by using AAVproR titration kit ver.2 (Takara).
-
bioRxiv - Immunology 2020Quote: ... Cells were counted and seeded at 3 million cells in 1 mL of media with 2x hIL-2 into each well of a 6 well plate that was coated with 15 µg/mL of RetroNectin (Takara, Cat# T100A) for 3 hours at room temperature and subsequently washed with 1x PBS ...
-
bioRxiv - Genomics 2023Quote: ... A total of 3.5 μl ribo-depleted material was used for SMARTer (SMARTer PCR cDNA Synthesis Kit, catalog num. 634926 and Advantage 2 PCR kit, catalog num. 639207, Clontech-Takara) protocol ...
-
bioRxiv - Cell Biology 2022Quote: cDNA was generated from single cells in the 96-well plate using the SmartSeq v4 kits (Takara Bio) using 1/4th volume reactions dispensed using a Mantis dispenser (Formulatrix) ...
-
bioRxiv - Cell Biology 2020Quote: ... nested PCR was performed using PCR Mycoplasma Detection Set (Takara, 6601).
-
bioRxiv - Evolutionary Biology 2020Quote: PCR amplification was carried out using the Advantage GC 2 PCR Kit (Clontech Catalog #639119), and cloning was carried out using standard procedures (primer sequences are listed below).
-
bioRxiv - Genomics 2021Quote: ... and 2) the reduction of the amount of PrimeStar GXL DNA Polymerase kit (Takara, Japan) from 2 ul to 1 ul per reaction.
-
bioRxiv - Immunology 2020Quote: ... SARS-CoV-2 infected patients were confirmed using a RT-qPCR kit (TaKaRa, Dalian, China) as recommended by the China CDC.
-
bioRxiv - Microbiology 2023Quote: ... 2×SYBR Green PCR Mastermix (RR820A) and reverse transcription kit (RR047A) were purchased from TAKARA company ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was amplified by 15 cycles of PCR using the Advantage 2 PCR Kit (Clontech) with template switching custom oligo (TableS6) ...
-
bioRxiv - Genomics 2019Quote: The 90-μL preparation volume for PCR contains 1X Advantage 2 PCR Buffer [not short amplicon (SA)](10X, Clontech, 639206, Advantage® 2 PCR Kit), 0.4-mM dNTP Mix (50X/10 mM ...
-
bioRxiv - Molecular Biology 2021Quote: 20 cm plates of HEK293T cells were transfected with 10 µg of each plasmid using CalPhos transfection kit (Takara) according to manufacturer’s instructions and harvested 3 days later ...
-
bioRxiv - Microbiology 2022Quote: ... Total RNA (2 μg) was used for reverse transcription with the PrimeScriptTM RT reagent Kit (TaKaRa). Quantitative expression assays were performed by using the 2x M5 HiPer SYBR Premix EsTag kit (Mei5bio ...
-
bioRxiv - Microbiology 2021Quote: ... two to four overlapping DNA fragments were PCR amplified (Advantage HF 2 PCR Kit from Clontech) using primers described Table S4 ...
-
bioRxiv - Immunology 2020Quote: ... PCR samples were indexed with Nextera Illumina Indices reads using the Advantage 2 PCR kit (Clontech) in a 8 PCR cycle reaction and purified with Agencourt AMPpure XP beads (Beckman Coulter ...
-
bioRxiv - Immunology 2021Quote: ... AAV6 vector genomes were titrated by ITR-specific quantitative PCR (Takara AAVpro Titration Kit Ver.2) per the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: ... and treated with Exonuclease I (New EnglandBiolabs) before amplification by the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 μg of RNA was converted to cDNA using PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa) in SureCycler 8800 (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 μg of genomic DNA was used as a template using Titanium Taq PCR kit (Takara). The sequence information for the primers used for barcode amplification was kindly provided by Novartis and can be found in Supplementary Table 4 ...
-
bioRxiv - Microbiology 2024Quote: ... UMI-tagged spike gene cDNA was amplified using the Advantage 2 PCR kit (Takara Bio, 639206) with forward primer TTCGCATGGTGGACAGCCTTTGTT and reverse primer CCGCTCCGTCCGACGACTCACTATA under the following thermocycling conditions ...
-
bioRxiv - Immunology 2020Quote: ... qPCR was then carried out using SyberGreen based detection methods (Takara Biosciences). Fold induction relative to the wild type unstimulated sample was calculated as described using 18s and/or GAPDH as reference gene [36] ...
-
bioRxiv - Biochemistry 2020Quote: ... detected by the PCR Mycoplasma Detection Set (TAKARA BIO INC, Kusatsu, Japan).
-
bioRxiv - Neuroscience 2024Quote: ... Cultures were tested regularly for mycoplasma (6601; TaKaRa PCR Mycoplasma Detection Set).
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were extracted from all the colonies which grew on QDO/X/A agar plate using Easy Yeast Plasmid Isolation Kit (TaKaRa). PCR was carried out using the extracted plasmids as template ...
-
bioRxiv - Cell Biology 2021Quote: Transfection of Halo-tagged AnkB440 plasmids were conducted in HEK293T cells grown in 10 cm culture plates using the calcium phosphate transfection kit (Takara) and 8 µg of plasmid ...
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
bioRxiv - Cancer Biology 2023Quote: ... non-adherent plate (Takara Bio). Cells were grown for 14 days ...
-
bioRxiv - Immunology 2020Quote: ... the DNA-amplicons for Illumina sequencing were generated by using Advantage 2 PCR Kit (TAKARA Bio Europe), employing a mTCRβ reverse primer and a Universal primer mix (UPM) ...
-
bioRxiv - Bioengineering 2024Quote: ... Viral genome number was quantified by real-time PCR with AAVpro Titration Kit Ver.2 (Takara, 6233) according to manufacturer’s instruction ...
-
bioRxiv - Cell Biology 2021Quote: ... BacT/ALERT 3D Microbial Identification System and PCR Mycoplasma Detection Set (Takara, 6601) were applied to detect bacterial/fungi and mycoplasma contamination ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Cell Biology 2022Quote: Cells cultured in either 12- or 24-well plates were washed twice with cold PBS and harvested using a TaKaRa MiniBEST universal RNA extraction kit (Takara, Japan). RNA was purified using the same kit according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: Cells cultured in either 12 or 24-well plates were washed twice with cold PBS and harvested using TaKaRa MiniBEST Universal RNA extraction kit (Takara, Japan). RNA was purified using the same kit according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Plates were coated with 5μg/mL of target peptide using coating reagent from the Takara Peptide Coating Kit (Takara cat. #MK100). Measles peptide was utilized as a negative control ...
-
bioRxiv - Cancer Biology 2023Quote: Reverse Transcriptase PCR and Real-Time PCR Cells cultured in either 12- or 24-well plates were washed twice with cold PBS and harvested using a TaKaRa MiniBEST universal RNA extraction kit (Takara, Japan). RNA was purified using the same kit according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Physiology 2022Quote: ... cDNA was synthesized using 2 μg RNA using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). Gene specific primers for quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Developmental Biology 2022Quote: Purified total RNA was reverse transcribed into cDNA by PrimeScript™ 2 1st strand cDNA Synthesis Kit (TaKaRa). The target gene fragments (Brachyury ...
-
bioRxiv - Plant Biology 2021Quote: ... URA3: GAL1UAS–Gal1TATA–LacZ MEL1) via the Yeastmaker™ Yeast Transformation System 2 kit (Clontech, Mountain View, USA). An agarose gel image of the cDNA library is shown in Fig ...