Labshake search
Citations for Takara Bio :
1 - 50 of 1736 citations for GDNF family receptor alpha 1 GFRA1 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: Human Embryonic Kidney 293 (HEK293) cells (Clontech Laboratories) were used for most experiments described in this study ...
-
bioRxiv - Cell Biology 2023Quote: HEK293 (Clontech #C3003-1; lot #7030396) cell lines were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Cell Biology 2020Quote: ... His (Takara/Clontech 631212, 1:1000), GFP (Roche 11814460001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... JEG3 cells (human; sex: female, placenta epithelial), HEK293 derivative Lenti-X™ 293T cells (human; sex: female, kidney epithelial) obtained from Takara (cat. 632180), Huh-7.5 heptoma cells (human ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HEK293 cells (Takara 632180), C3H/10T1/2 Clone 8 (ATCC# CCL-226) ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 Tet-off cells (Clontech) were transfected with pTRE-TIGHT plasmids bearing the (de)optimized and WT sequences and incubated overnight at 37ºC ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293 Tet-ON cells (Clontech) were co-transfected with linearized pTRE-HTT128Q together with a plasmid expressing a hygromycin resistance gene ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293 cells were co-transfected either with pEGFP-N1 (Clontech, 6085-1) or pCAG-DsRed-T1 (gift from Prof ...
-
bioRxiv - Neuroscience 2020Quote: We transiently co-transfected cDNA constructs of GluN1 and GluN2A into mammalian human embryonic kidney 293 (HEK293) with a separate pEGFP-Cl vector (Clontech) at a ratio of 4.5:4.5:1 (GluN1/GluN2A/EGFP ...
-
bioRxiv - Molecular Biology 2023Quote: ... His (Clontech), supplemented with 1.5 mM 3-amino-1,2,4-triazol (3-AT ...
-
bioRxiv - Cell Biology 2020Quote: ... 7.5 × 107 Hek293-lentiX cells (Clontech) were seeded on 15-cm tissue culture plates ...
-
bioRxiv - Cancer Biology 2019Quote: HEK293 Lenti-X (Clontech, Cat. # 632180) cells were cultured in DMEM with 10% FBS ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630428, Clontech) or –Trp ...
-
bioRxiv - Developmental Biology 2021Quote: ... –His (630419, Clontech) selective media +3 mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (Clontech) with and without the addition of 3-Amino-1H-1,2,4-triazole (Acros Organics (Thermo Fisher Scientific) ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293S Lenti-X producer cells (Takara/Clontech) were transfected in DMEM with 2 % (v/v ...
-
bioRxiv - Biophysics 2021Quote: ... HEK293S Lenti-X producer cells (Takara/Clontech) were transfected in DMEM with 2 % (v/v ...
-
bioRxiv - Bioengineering 2023Quote: HEK293 cells (DMSZ) and HEK293T cells (Takara) were maintained in Dulbecco’s modified Eagle’s medium (DMEM ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Immunology 2019Quote: ... HEK293 cells were transfected using Xfect (TakaRa, #631318) with the viral packaging construct [pMDLg/pRRE (Addgene ...
-
bioRxiv - Cell Biology 2022Quote: ... Lenti-X HEK293 cells (Takara Bio, Cat #632180) were transfected with pHR-SFFV-dCas9-BFP-KRAB ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-His (Clontech 631212), anti-H3K36me2 (Upstate 07-369) ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Synthetic Biology 2021Quote: ... 2021: Escherichia coli DH5 alpha (Takara (Korea)) ...
-
bioRxiv - Microbiology 2023Quote: ... His-tagged mCherry (mCherry-His) was PCR amplified from pmCherry-C1 vector (Takara) templates with primers encoding a His-tag and NcoI/NotI cut sites (Takara) ...
-
bioRxiv - Immunology 2024Quote: ... genes encoding the variable regions of C7 and C74 heavy chains were cloned into a pMN vector with a human CH1 domain and a C-terminal His-tag using In-Fusion cloning system (Takara Bio #639649). The full light chains of C7 and C74 were cloned into the pMN vector without any purification tag using the same method ...
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Developmental Biology 2023Quote: ... Interactions were evaluated on agar that was -His or -His -Ade (Clontech, now Takara Bio). Growth in the absence of either supplement indicates transcription from reconstituted GAL4 proteins ...
-
bioRxiv - Immunology 2021Quote: ... with the modification that Ecotropic Receptor Booster (Takara, #631471) was added to the cells as suggested by the manufacturer ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Microbiology 2020Quote: ... CloneAmp Hi-Fi PCR Premix (Takara) and the following PCR conditions were used to generate the amplicons ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293 cells were first incubated with ARIAD ligand at a concentration of 1 µM (AL; D/D Solubilizer; Takara) for the indicated times ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific cytoplasm (TAKARA, Stem121, 1:500), anti-TBR2 (Abcam ...
-
bioRxiv - Bioengineering 2019Quote: ... SD-His or SD-Trp-Ura (Clontech). Mycoplasma pneumoniae strain M129 (ATCC 29342) ...
-
bioRxiv - Cell Biology 2023Quote: ... His-tagged recombinant proteins were isolated by 1 h incubation with Talon metal affinity resin (Clontech) at room temperature ...
-
bioRxiv - Cancer Biology 2019Quote: ... embryonic kidney cell line HEK293(ATCC CRL-1573) and 293GP cells (Clontech) were cultured in high glucose (5g/l ...
-
bioRxiv - Immunology 2023Quote: ... CPER products were transfected into HEK293-C34 cells using TransIT-LT1 (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... anti-human nuclei (STEM101; Takara, Y40400, IgG1, 1:100) and anti-human NOGOA (Santa Cruz Biotechnology ...
-
bioRxiv - Cell Biology 2023Quote: ... anti-human specific GFAP (hGFAP, TAKARA, Stem123, 1:1000), anti-AQP4 (Cell Signaling ...
-
bioRxiv - Microbiology 2019Quote: ... and loaded on His 60 Ni resin (TAKARA) after equilibrating ...
-
bioRxiv - Microbiology 2022Quote: ... Western blots using Anti-His primary antibody (Clontech) (1:4000 dilution ...
-
bioRxiv - Plant Biology 2021Quote: ... whereas selective media additionally lacked His (−4) (Clontech).
-
bioRxiv - Molecular Biology 2019Quote: ... Clarified lysates were incubated with HIS-60 (Takara) resin for 30-60 minutes ...
-
bioRxiv - Cell Biology 2021Quote: ... The HEK293-based Lenti-X 293T (HEK293T) cell line was obtained from Takara Bio (Shiga ...
-
bioRxiv - Plant Biology 2020Quote: ... 3-μL aliquots of each dilution were used to inoculate SD/−Trp/−His/−Ade medium and SD/−Trp/−His medium with X-α-Gal (Clontech). The inoculated media were incubated for 4 days at 30 °C ...
-
bioRxiv - Microbiology 2021Quote: ... His-Raf1, His-ATG8) and empty plasmids (GST tag, 6×His tag) were transformed into component cells Escherichia coli BL21 (Takara, 9126) or BL21 (DE3 ...
-
bioRxiv - Genomics 2023Quote: ... 100 ng to 1 µg of total RNA was used for Hi-Mammalian whole transcriptome preparation (Takara Bio) and sequencing was performed on Nextseq2000 instrument with 1 x 72 bp single-end setup ...