Labshake search
Citations for Takara Bio :
301 - 348 of 348 citations for Ephrin A5 EFNA5 Fc HEK293 Human since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... mEmerald/ mApple -VTA1: full-length human VTA1 was amplified by PCR and cloned to mEmerald or mApple -C1 vectors (Clontech). mCh-CHMP4C ...
-
bioRxiv - Systems Biology 2024Quote: SW1353 cells were purchased from ATCC Full length miRNA target 3’UTRs were amplified from human genomic DNA using PCR primers (Supplementary Table 4) to enable Clontech In-Fusion HD cloning (Takara Bio Europe ...
-
bioRxiv - Cell Biology 2024Quote: A PCR product containing the Human ORF for DDX3X was obtained directly from RNA using the Primescript High Fidelity RT-PCR kit from Takara. The PCR primers introduced BamHI and NotI sites at the 5’ and 3’ ends respectively ...
-
bioRxiv - Molecular Biology 2024Quote: ... The N-terminal His tag construct of human MPST was co-transformed with GroES-EL chaperon plasmid from Takara (#3340), overexpressed in E ...
-
bioRxiv - Genomics 2019Quote: ... We additionally PCR amplified the region from genomic DNA for sample NA12878 with 12 copies of AC (NIGMS Human Genetic Repository, Coriell) using PrimeSTAR max DNA Polymerase (Clontech R045B) and primers RFT1eSTR_F and RFT1eSTR_R (Supplementary Table 8 ...
-
bioRxiv - Cell Biology 2019Quote: ... was produced by cloning a gene block (IDT) comprising a human codon optimized C10 Δ(45 - 69) into a YFP-N1 vector (Clontech) digested with NotI and BamHI to replace the YFP insert ...
-
bioRxiv - Neuroscience 2020Quote: Bacterial expression plasmids encoding mouse and human WT-α-synuclein in the inducible pRK172 backbone were transformed into BL21-CodonPlus (DE3) cells (Clontech). Cell pellets were lysed in 0.75M NaCl ...
-
bioRxiv - Cell Biology 2021Quote: Plasmids for the pull-down assay were constructed by cloning human Kif7 and Gli2 sequences into pCMV-BICEP™-4 expression vector followed by truncations using InFusion HD Cloning Kit (Takara). Kif7 fragments were cloned at the MCS1 to express FLAG-tagged Kif7 protein and Gli2 fragments were cloned at the MCS2 to express c-myc-tagged Gli2 protein ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCGF1-4) and CBX1-8 cDNAs were amplified from human ES cell cDNA library and inserted to pGAD-T7 (Takara, 630442) and pGBK-T7 (Takara ...
-
bioRxiv - Molecular Biology 2020Quote: ... Illumina data from human HEK293T cells were processed with the SMARTer® smRNA-Seq Kit for Illumina (Takara, Cat. Nos. 635029) following guidelines ...
-
bioRxiv - Genetics 2021Quote: Gene expression profiling of 297 genes from IBD-associated loci was performed across a panel of different RNAs from human tissues (n=1, purchased from Clontech Laboratories) and from different immortalized intestinal and immune cell lines (n=3 ...
-
bioRxiv - Neuroscience 2021Quote: Plasmids encoding GST-BVR (GST-BVRα) and GST-BVRβ were generated by cloning cDNA of human BLVRA and BLVRB into pCMV-GST vector (Clontech/TaKaRa). The construct encoding myc-FAK was generated as previously described (95) ...
-
bioRxiv - Neuroscience 2021Quote: The desired ORF for Pdlim7 (Gene bank ID: AF345904.1) was amplified by PCR from Human Universal QUICK-Clone™ II (Takara 637260) using primers depicted in Table S2 and inserted into pEGFP-C1 plasmid through Gibson assembly.
-
Heat Shock Factor 1 (HSF1) as a new tethering factor for ESR1 supporting its action in breast cancerbioRxiv - Cancer Biology 2021Quote: The shRNA target sequence for human HSF1 (NM_005526.4) was selected using the RNAi Target Sequence Selector (Clontech, Mountain View, CA, USA). The target sequences were ...
-
bioRxiv - Microbiology 2021Quote: ... Phage libraries were constructed using antibody gene fragments amplified from PBMCs of 50 healthy human subjects (Allcells, PB003F and PB003C) and total RNA from PBMCs (TaKaRa, 636592), spleens (TaKaRa ...
-
bioRxiv - Cell Biology 2023Quote: ... The coding sequence of EPHX2 was amplified by PCR from liver cDNA (Human Multiple Tissue cDNA panels; Takara Bio, Shiga, Japan) using primers (5’-GTCGACATGACGCTGCGCGCGGCCGTCTTCG-3’ ...
-
bioRxiv - Cell Biology 2023Quote: The plasmid pEGFP-N1–VMP1 was obtained by inserting the human VMP1 sequence (NCBI reference sequence: NM_030938.5) into pEGFP-N1 (CLONTECH cat. #6085-1). The plasmid pcDNA4-B–hVMP1–V5/His was obtained by inserting the human VMP1 sequence (NM_030938.5 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CDS of fluorescent proteins were subcloned into pET-human αSyn51 using the KOD-Plus Mutagenesis kit (TOYOBO) and In-Fusion HD Cloning Kit (Takara Bio) according to the manufacturers’ protocol ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR for pluripotency and trilineage spontaneous differentiation was performed according to the instruction manual of the human ES cell Primer Array (Takara Clontech).
-
bioRxiv - Biochemistry 2023Quote: Mouse UCP1 gene and human codon-optimized mitoLbNOX and LbNOX (addgene #74448 and #75285) were cloned into pLVX-TRE3G vector (Clontech, CA) using Gibson assembly ...
-
bioRxiv - Cell Biology 2020Quote: The yeast strain AH109 was co-transfected with bait vector full-length human SNX4 or Lamin cloned into pGBKT7 (Clontech, Oxford, UK) against a pray library of FL SNX-BARs ...
-
bioRxiv - Biochemistry 2022Quote: ... DNA ligation of the linearised pOPINTTGneo vector and the human UGGT1insert was achieved by In-fusion™ligation-independent cloning (Takara Ltd.)
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Cancer Biology 2022Quote: ... Plasmid pMSCV-GADD34-puro contains the human PPP1R15A (GADD34, NM_014330.5) gene subcloned into the NcoI/EcoRI sites of the retroviral vector pMSCV-puro (Clontech Laboratories, Mountain View, CA).
-
bioRxiv - Immunology 2022Quote: Matched healthy donor RNA was used to generate targeted IgG and IgM AIRR-seq libraries using the SMARTer Human BCR IgG IgM H/K/L Profiling Kit (Takara Bio USA) according to the manufacturer’s instructions with no modifications ...
-
bioRxiv - Immunology 2022Quote: Total RNA was isolated from RAW264.7 cells and ground cartilage from human tibial plateaus using TRIzol reagent (Takara Bio Inc., Shiga, Japan). For mRNA quantification ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer specificity and amplification efficiency for genes of interest were verified by performing reactions on a dilution series of human reference cDNA (Takara, cat# 636693). Gene expression relative to GAPDH and RPLP0 house-keeping genes was calculated in Microsoft Excel ...
-
bioRxiv - Immunology 2024Quote: ... genes encoding the variable regions of C7 and C74 heavy chains were cloned into a pMN vector with a human CH1 domain and a C-terminal His-tag using In-Fusion cloning system (Takara Bio #639649). The full light chains of C7 and C74 were cloned into the pMN vector without any purification tag using the same method ...
-
bioRxiv - Cancer Biology 2020Quote: ... and TRIM27 cDNA was obtained in pENTR221 vectors from the UT Southwestern (UTSW) McDermott Center for Human Genetics and subcloned into pCMV-HA or pCMV-myc (Clontech, Mountain View, CA) between SalI and NotI restriction sites ...
-
bioRxiv - Systems Biology 2019Quote: ... PCR amplification allowed to obtain the coding sequence for human HSF1 that was cloned into peGFP N3 vector (Clontech Laboratories Mountain View, CA); the plasmid was then verified by sequencing (GATC Biotech ...
-
bioRxiv - Immunology 2022Quote: ... Viruses were packaged in human embryonic kidney (HEK) 293 cells and viral supernatants were processed using Retro-X concentrators (Takara Bio. USA Inc). Naïve CD8 T cells were purified by negative-selection and stimulated in vitro with plate-bound anti- CD3/CD28 ...
-
bioRxiv - Neuroscience 2021Quote: ... under control of the modified human GFAP promoter, GfaABC1D (Lee et al., 2008) using restriction cloning and In-Fusion HD assembly (Clontech, Takara Bio, USA). The following sequence elements were obtained from Addgene ...
-
bioRxiv - Biochemistry 2021Quote: A cDNA fragment encoding full-length human EGFR (UniProt accession no. P00533) was cloned into the pEGFP-N1 plasmid (Clontech, Mountain View, CA). To facilitate affinity purification ...
-
bioRxiv - Immunology 2021Quote: ... T cell receptor sequencing libraries were prepared with the SMARTer Human TCR α/β Profiling Kit (catalog number 635015, Takara Bio USA, Inc.) according to manufacturer’s instructions with the exception of excluding the third and fourth bead size selection steps listed in Table 3 of the kit manual ...
-
bioRxiv - Cell Biology 2022Quote: Mouse NIH/3T3 (ATCC, cat# CRL-1658), human IMR-90 (ATCC, cat# CCL-186) and Lenti-X™ 293T (Takara Bio, cat# 632180) cell lines were cultured in full-DMEM (Corning ...
-
bioRxiv - Cancer Biology 2023Quote: ... and 1.25Lμg pVSV-G (second-generation lentivirus packaging system) into human embryonic kidney packaging cells GP2-293 (Clontech, Inc., Mountain View, CA, USA), using CalPhos™ Mammalian Transfection Kit (Clontech ...
-
bioRxiv - Neuroscience 2022Quote: Human embryonic stem cell (hESC)-derived cerebral organoids (hCOs) were generated from a commercially available hESC stem cell line (Takara Bio, Osaka, Japan), using the STEMdiff cerebral organoid kit (STEMCELL Technologies ...
-
bioRxiv - Cell Biology 2024Quote: ... A bicistronic construct expressing human EPAC1b with a C-terminal His10 tag and SUMO3(Q89K) was constructed using the pIRES2-EGFP vector (Clontech Catalog no. 632435). The EPAC1-His10-IRES-SUMO3(Q89K ...
-
bioRxiv - Neuroscience 2022Quote: ... Constructs for human Tara were prepared by cloning full-length TRIOBP1 (Trio and F-actin binding protein1) isoform into pEGFP-C3 (Clontech, Mountain View, CA, USA), pFLAG-CMV2 (Sigma-Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... which is an abundant splice isoform in human brain26 was engineered in the mammalian expression vector pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA). The EGFP-expressing vector was used for transfection of WT or variant KCNQ2 into CHO-Q3 cells (homozygous state) ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2023Quote: ... downstream of the Myh6 (α- myosin heavy chain) promoter and upstream of a human growth hormone polyadenylation signal using In-Fusion HD (Takara Bio cat# 011614). The final transgenic targeting construct was verified by DNA sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... the structural homologue regions from human and gecko EVX1AS were in vitro transcribed (IVT) using a T7 RNA Polymerase (Takara Bio, San Jose, CA). IVT lncRNAs were then purified ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... were subcloned into pCS2-3×Flag (Wang et al., 2017) or pmCherry-N1 and CDSs encoding CASP (pufferfish, human and mouse) were subcloned into p-CMV-Myc (Clontech, Mountain View, CA, USA) or pCS2-Myc (Wang et al. ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The Northern dot blots containing cDNAs from primary human tumors (T) with paired adjacent normal tissues (N) and cancer cell lines were obtained from Clontech (Cancer Profiling Array, #7840-1). The blots contained normalized cDNA isolated from tumors and the corresponding adjacent normal tissues from individual cancer patients ...