Labshake search
Citations for Takara Bio :
1 - 50 of 5996 citations for Endothelin 1 ET 1 ELISA Kit 1 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... pmCherry-C1(Picard et al., 2006) and pEGFP-C1 (Clontech #6084-1) were used as respective vector control ...
-
bioRxiv - Cancer Biology 2023Quote: ... 150,000 cells were seeded in 6-well plates 1 day before transfection with 1 μg pp53-TA-Luc vector (Clontech) and 0.015 μg pRL-CMV-Renilla (Promega ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... were co-transfected into HEK293T cells at a 1:1:1:1.6:4.6 ratio using CalPhos mammalian transfection kit (TaKaRa Clontech, Mountain View, CA #631312) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 × 106 PBMCs were plated on retronectin coated 6-well plates (Takara Clonetech) with retroviral vectors and centrifuged at 1,000 × g for 40 min ...
-
bioRxiv - Genetics 2022Quote: ... 1 μgml−1 doxcycline (TAKARA Bio) and 10−6 M dexamethasone (Sigma Aldrich).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µM Shield-1 (Takara # 632189) for 4 hours ...
-
bioRxiv - Biochemistry 2019Quote: ... coli MS115-1 (CD-NTase018 from (Whiteley et al., 2019)) were synthesized (GeneArt) and inserted into vectors pBridge and pGADT7 (Clontech) by isothermal assembly ...
-
bioRxiv - Cell Biology 2020Quote: ... GFP CIZ1 C275 was made by ligating the 1 kb C-terminal XhoI fragment (Coverley et al., 2005) into the XhoI site of pEGFP-C2 (Clontech). GFP CIZ1 Δp8 (this study ...
-
KIF24 controls the clustering of supernumerary centrosomes in pancreatic ductal adenocarcinoma cellsbioRxiv - Cell Biology 2022Quote: ... human KIF24 fragments encoding residue 1-4383 was excised from pEGFP-C1-KIF24 (Kobayashi et al., 2011) and sub-cloned into pLVX-IRES-Puro (Clontech). KIF24/TS621-622AA (TS ...
-
bioRxiv - Neuroscience 2023Quote: ... GFP-T42EM was created by cloning T42EM (Ding et al., 2006) into the HindIII and BamHI sites of the pEGFP-C1 plasmid (6084-1, Clontech). To verify tau protein expression ...
-
bioRxiv - Bioengineering 2020Quote: ... were mixed at a 1:1:1 ratio and bound to retronectin (Clontech)-coated plates according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... tubes with 1:1 FBS:PBS supplemented with recombinant RNase inhibitor (1:100, Takara). The live singlet gated CD3+ T cells were further gated as per the gating strategy shown in additional file 1 ...
-
bioRxiv - Cancer Biology 2020Quote: HCF-1VIC (residues 1-380) from pCGT-HCF1VIC (Thomas et al., 2016) was cloned into pT7-IRES His-N (Takara 3290) using BamHI-HF (NEB R3136 ...
-
bioRxiv - Immunology 2021Quote: ... and the NES sequence of the HIV-1 rev protein into pT2ADW vector (Komatsu et al., 2018) by In-Fusion cloning (Takara Bio).
-
bioRxiv - Cancer Biology 2021Quote: ... a WST-1 cell proliferation assay kit (MK400, Takara Bio) was used according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... E-cadherin antibody (HECD-1, 1:1000 IF, 1:1000 WB) was from Takara Bio ...
-
bioRxiv - Neuroscience 2019Quote: ... Rabbit anti-dsRed (Clontech, 1:500-1:1000), Sheep anti-GFP (Bio-Rad ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DsRed (1:200-1:500, Clontech), mouse anti-1D4 anti-Fasciclin II (1:10 ...
-
bioRxiv - Cell Biology 2020Quote: Lenti-X™ p24 Rapid Titration ELISA Kit (TaKaRa) was used to determine virus titer ...
-
bioRxiv - Molecular Biology 2020Quote: ... HRP-linked (1:2000, Takara, japan, Cat#T7122A-1);
-
bioRxiv - Molecular Biology 2021Quote: ... HRP-linked (1:2000, Takara, Japan, Cat# T7122A-1).
-
bioRxiv - Neuroscience 2024Quote: ... Rabbit anti-dsRed (Takara 632496, 1:1,000–1:2,000), and Chicken anti-GFP (Aves GFP-1020 ...
-
bioRxiv - Genomics 2019Quote: ... 1-mM SMARTer Kit dNTP Mix (10 mM each; Clontech, 634936), 1.2-μM SMARTer Kit SMARTer II A Oligonucleotide (12 μM ...
-
The Ets protein Pointed P1 represses Asense expression in type II neuroblasts by activating TaillessbioRxiv - Developmental Biology 2021Quote: ... 1-298) (EnR) or the Ets domain of PntP1 were amplified by CloneAmp HiFi PCR Premix (Catalog# 639298, Takara Bio., Mountain View, CA) from genomic DNAs of the UAS-PntP1 line ...
-
bioRxiv - Genetics 2020Quote: ... Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al. 2010) using the PrimeSTAR GxL kit (Takara). Primers are F1/R1 (ATGGCTTCTGCATCAACTTC / TGGAATTCGATTTCGGGAC ...
-
bioRxiv - Genetics 2021Quote: ... prepare non-tissue culture treated plates by adding RetroNectin (1 μg/μL; Takara Bio, Otsu, Japan) to enhance transduction efficiency ...
-
bioRxiv - Microbiology 2022Quote: ... 1% PS and doxycycline (1 μg/ml; Takara, Cat# 1311N). At 7 days posttransfection ...
-
bioRxiv - Microbiology 2022Quote: ... 1% PS and doxycycline (1 μg/ml; Takara, Cat# 1311N). At six days posttransfection ...
-
bioRxiv - Microbiology 2021Quote: ... 1% PS and doxycycline (1 μg/ml; Takara, cat# 1311N). At six days posttransfection ...
-
bioRxiv - Genomics 2019Quote: ... 1-U/μL SMARTer Kit RNase Inhibitor (40 U/μL; Clontech, 634936), 10-U/μL SMARTScribe™ Reverse Transcriptase (100 U/μL ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 1 µM of Shield-1 peptide (Clontech, Mountain View CA) for 4-6 hours ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 1 μM of Shield-1 peptide (Clontech, Mountain View CA) for 4 h ...
-
bioRxiv - Molecular Biology 2024Quote: - IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Molecular Biology 2024Quote: IgG detector solution V2 (1:2000 dilution, Takara, Cat# T7122A-1).
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Cancer Biology 2021Quote: ... residues 1-217) and CrkII (Uniprot P46108-1; residues 1-330) were each cloned into a modified pCOLD IV vector (Takara) that contains a N-terminal His TEV cleavage tag by Genscript ...
-
bioRxiv - Biochemistry 2022Quote: ... 1-206) and SYCE3 (1-88) were cloned into pGBKT7 vectors (Clontech) and human sequences for SYCP1 (1-811) ...
-
bioRxiv - Neuroscience 2022Quote: ... rat anti-GFP (1:200;) and rabbit anti-dsRed (1:600; Clontech). The anti-GFP and anti-dsRed antibodies were used to amplify the intrinsic fluorescent signals in the Ccr2RFP/+fmsEGFP/+ mice ...
-
bioRxiv - Immunology 2024Quote: ... TALON metal affinity resin (Takara, #635653, 0.5-1:1 v/v ratio) was washed with PBS and added to the supernatant ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Microbiology 2022Quote: ... the lentiviral transfer plasmid pCSII-EF-luciferase (Agarwal et al., 2006), and pCMV-VSV-G (Stewart et al., 2003) using the CalPhos Mammalian Transfection Kit (Takara Bio Company, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2020Quote: ... dsRed (1:1000, Clontech), GFP (1:1000 ...
-
bioRxiv - Genomics 2021Quote: ... 1 mM dNTPs (Clontech), 1 U/mL RNase inhibitor ...
-
bioRxiv - Neuroscience 2020Quote: ... STEM121 (1:200, Takara), TH (1:200 ...
-
bioRxiv - Molecular Biology 2022Quote: ... AP21967 (1 μM, TaKaRa).
-
bioRxiv - Neuroscience 2023Quote: pmCherry-1 (632525, Clontech) was used as the backbone and control vector for the overexpression experiments ...
-
bioRxiv - Genetics 2024Quote: ... 1 mM dNTPs (Clontech), 1 U/mL RNase inhibitor ...
-
bioRxiv - Microbiology 2019Quote: ... 1 × GC buffer II and 1 U of LA Taq DNA polymerase (TaKaRa). The PCR cycles consisted of 95 °C for 5 min ...