Labshake search
Citations for Takara Bio :
1 - 50 of 190 citations for Ebola Virus Envelope Glycoprotein GP1 Zaire Kikwit 95 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... expressing Moloney murine leukemia virus gag and pol genes was co-transfected with pLNCX2 vector with the FLAG-APEX2-GARG1060 insert and a plasmid coding for the vesicular stomatitis virus envelope glycoprotein (Takara Bio) using Mirus 2020 DNA transfection reagent (Mirus) ...
-
bioRxiv - Cell Biology 2023Quote: ... Retroviruses with the vesicular stomatitis virus–G (VSV-G) envelope were produced by transfection of GP2-293 cells (Clontech) with the pRetroX construct and pVSV-G (Clontech ...
-
bioRxiv - Immunology 2021Quote: ... envelope vector into Lenti-X 293T cells (Clontech) using Lipofectamine 2000 (Invitrogen) ...
-
bioRxiv - Cancer Biology 2023Quote: ... virus-containing media was harvested for virus isolation using Lenti-X concentrator (Takara) in lieu of ultracentrifugation ...
-
bioRxiv - Cell Biology 2021Quote: ... the Lenti-XTM Packaging Single Shots (vesicular stomatitis glycoprotein pseudotyped version) system from Takara Bio Europe was used according to the manufacturer’s instructions (631275) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Virus containing supernatant was collected and virus particles were concentrated by Lenti-X concentrator (Clontech Laboratories, CA) according to the manufacturer protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... The full-length Spike glycoprotein was subsequently amplified with Prime Star GXL DNA polymerase (Takara Bio) and the following primers CoV-SF GATAAAGGAGTTGCACCAGGTACAGCTGTTTTAAG CoV-SR GTCGTCGTCGGTTCATCATAAATTGGTTCC and conditions as per previously described50 ...
-
bioRxiv - Immunology 2022Quote: ... GP2-293 retroviral packaging cells and the p10A1 envelope vector were purchased from Clontech. Lipofectamine 3000 was purchased from ThermoFisher and Polybrene was purchased from Sigma ...
-
bioRxiv - Neuroscience 2022Quote: ... and VSV-G (viral envelope) (Stewart et al., 2003) into Lenti-X HEK293T cells (Clontech) at a mass ratio of 5:4:3 using polyethyleneimine (PEI) ...
-
bioRxiv - Pathology 2021Quote: ... Viral titering was performed using 15 μL of unconcentrated virus or 1.5 μl of concentrated virus with the Lenti-X qRT-PCR Titration Kit (Clontech, 632165). Results were read on an ABI QuantStudio 6 RT-PCR machine.
-
bioRxiv - Biophysics 2022Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and resuspended in DPBS before being applied to neurons.
-
bioRxiv - Cell Biology 2022Quote: ... The virus titer (ifu/ml) defined by Clontech’s Lenti-X qRT-PCR Titration Kit (Cat ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: ... Virus was precipitated using Lenti X-concentrator (Takara) following the manufacturer’s recommendations ...
-
bioRxiv - Genomics 2024Quote: ... Virus was concentrated using Lenti-X Concentrator (Takara) and titer quantified using p24 ELISA antigen assay (Takara) ...
-
bioRxiv - Immunology 2024Quote: ... Lentivirus was produced by transfecting 95 % confluent Lenti-X cells (Takara) grown in wells of 6-well plates with 1000 ng psPAX2 (Addgene plasmid #12260 ...
-
bioRxiv - Microbiology 2020Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech). Lentivirus titers from 48h and 72h were determined by plaque assay (data not shown ...
-
bioRxiv - Immunology 2019Quote: ... and virus was concentrated using Lenti-X Concentrator (Takara). Existing mIRAK1mCherry and Irak1−/− iBMDM were then transduced with concentrated lentivirus ...
-
bioRxiv - Genomics 2021Quote: ... and virus was collected with LentiX Concentrator (Takara, # 631232). HUVEC were infected with combinations of two viruses and used 96 h after infection ...
-
bioRxiv - Neuroscience 2021Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech), and suspended in PBS.
-
bioRxiv - Microbiology 2019Quote: ... Virus packaging was assessed using Lenti-X GoStix (Clontech) but virus titers were not otherwise measured ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus was extracted using Lenti-X concentrator (Clontech Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus was extracted using Lenti-X concentrator (Clontech Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Virus was concentrated using LentiX concentrator (Takara, Shiga, Japan).
-
bioRxiv - Immunology 2023Quote: ... the virus was concentrated using RetroX concentrator reagent (Takara). Meanwhile ...
-
bioRxiv - Cancer Biology 2023Quote: ... Virus was concentrated with Lenti-XTM Concentrator from Takara and re-suspended in NeuroCultTM NS-A Complete Media.
-
bioRxiv - Bioengineering 2022Quote: ... Virus-containing supernatants were concentrated with Retro-X concentrator (Takara). PBMCs were stimulated for 2 days with CD3/CD28 T cell activation beads (Thermo # 11131D ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was extracted using Lenti-X™ concentrator (Clontech Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Virus was extracted using Lenti-X™ concentrator (Clontech Takara) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The virus was concentrated using Lenti-X Concentrator (Clontech, 631231), resuspended by one-twentieth volume of PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Neuroscience 2022Quote: ... Virus titers were measured using AAV titration kit (TaKaRa/Clontech) according to the manufacturer’s instructions by determining the number of DNase Iresistant vg using qPCR (StepOne ...
-
bioRxiv - Neuroscience 2022Quote: ... The virus-containing media was concentrated with LentiX Concentrator (Takara) and resuspended in Neurobasal (Gibco).
-
bioRxiv - Bioengineering 2023Quote: ... All virus was titrated with Lenti-X GoStix Plus (Takara) before being aliquoted and stored in −80 °C.
-
bioRxiv - Bioengineering 2023Quote: ... Virus was titered using Lenti-X GoStix Plus (Takara Bio). Lentivirus encoding GFP was purchased by VectorBuilder (Chicago ...
-
bioRxiv - Bioengineering 2023Quote: ... The virus titer was determined using AAVPro titration kit (Takara).
-
bioRxiv - Bioengineering 2023Quote: ... Virus titers were determined using AAVpro Titration Kit Ver2 (TaKaRa).
-
bioRxiv - Molecular Biology 2023Quote: ... Virus was concentrated 100 times by Lenti-X Concentrator (Takara) after filtering through a 0.45 syringe filter ...
-
bioRxiv - Cancer Biology 2023Quote: ... The filtered virus was concentrated using the LentiX concentrator (Takara) at 1500 x g for 45 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... and the NucleoSpin RNA Virus was from Takara (cat. 740956)
-
bioRxiv - Neuroscience 2024Quote: ... Collected crude virus was concentrated with Lenti-X (Takara Bio) following manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... Virus was concentrated with polyethylene glycol (Lenti-X, Takara, #631232). Lentivirus was produced in airway epithelial cell expansion medium supplemented with Y27632 and retinoic acid as described95 ...
-
bioRxiv - Cell Biology 2024Quote: ... Lentiviruses were produced by transfecting 293T cells with the pLVX constructs together with packaging and envelope vectors (Clontech) using the calcium phosphate precipitation method ...
-
bioRxiv - Plant Biology 2020Quote: ... Using the cDNA synthesis kit (TaKaRa: Moloney Murine Leukemia Virus Version), cDNA was synthesized from extracted RNA ...
-
bioRxiv - Cancer Biology 2020Quote: ... The titer of virus was measured using P24 ELISA kit (Clontech).The virus was aliquoted and stored at −80°C.
-
bioRxiv - Molecular Biology 2020Quote: ... virus supernatant was concentrated with Lenti-X™ Concentrator (Takara, #631231) as per the manufacturer’s protocol.
-
bioRxiv - Biochemistry 2020Quote: ... Virus titer was determined using Lenti-XTM GoStixTM Plus (Takara Bio), and Huh7 cells were infected at a MOI of 5 ...
-
bioRxiv - Genetics 2022Quote: ... Virus titer was estimated using Lenti-X GoStix Plus (Takara, 631281) after 100x dilution ...
-
bioRxiv - Immunology 2023Quote: ... The virus titer was determined using Lenti-XTM GoStix Plus (Clontech).
-
bioRxiv - Cell Biology 2024Quote: ... The virus titer was determined using Lenti-X GoStix Plus (Clontech). To transduce hTCEpi cells ...
-
bioRxiv - Developmental Biology 2024Quote: ... Foamy virus was produced using Lenti-X 293T (Takara Bio, Kusatsu) generated as previously described and frozen at -80°C for long term storage42 ...