Labshake search
Citations for Takara Bio :
1 - 50 of 1281 citations for ETS Related Transcription Factor Elf 3 ELF3 Antibody HRP since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2024Quote: Expression for IFN-related genes was conducted by reverse transcription using the PrimeScript RT Reagent Kit (Perfect RealTime, Takara Bio Inc.). qPCR reaction was performed in duplicate using Takyon ROX SYBR MasterMix blue dTTP (Eurogentec ...
-
bioRxiv - Developmental Biology 2021Quote: The cDNAs for HA-tagged ELF3 were amplified from the KhES-1 cDNA library by PCR using PrimeSTAR GXL (Takara) and were subcloned into the pENTR/D entry vector (Invitrogen) ...
-
bioRxiv - Synthetic Biology 2024Quote: All cloning related PCRs were performed using PrimeStar HS polymerase (Takara: R040A). The integration plasmid ...
-
bioRxiv - Microbiology 2021Quote: Antibody sequencing was performed as previously described (Simonich et al., 2019; Vigdorovich et al., 2016) using the SMARTer RACE 5’/3’ Kit (Takara Bio USA Inc., Mountainview, CA). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... the entire ELF3 genomic sequence present in three HIF pairs was amplified using Ex Taq DNA Polymerase (Takara Bio, Kusatu, Shiga, Japan) and 1186 bp of promoter sequence upstream of the ELF3 start codon in HIF pair 10 was amplified using ALLin™ RPH Polymerase (highQu GmbH ...
-
bioRxiv - Developmental Biology 2021Quote: ... and as a prey to the activation domain of the GAL4 transcription factor (GAL4-AD) in plasmid pACT2 (Clontech). To monitor the induction of a HIS3 reporter gene by complexes of bait and prey fusion proteins ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2021Quote: Doxycycline-inducible overexpression of transcription factors was achieved using the Lenti-X Tet-On 3G Inducible Expression System (Clontech; Cat. No. 631363) following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... the SV40pA was replaced by the 3’UTR of msSOD2 (Kaltimbacher et al., 2006) amplified from mouse brain cDNA (Clontech 637301) using primers AA35 and AA36 and inserted into the XbaI and NotI sites ...
-
bioRxiv - Neuroscience 2022Quote: ... The following primary antibodies were used: mouse anti-Nc82 (Laissue et al., 1999) rabbit anti-DsRed (TaKaRa Bio ...
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Reverse transcription of mRNA was performed using 3-5 μg RNA with RNA to cDNA EcoDry Premix (Takara, #639549). For real-time PCR analysis ...
-
bioRxiv - Genetics 2020Quote: ... Reverse transcription was accomplished with Reverse Transcription Kit (Takara, RR037A) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... reverse transcription (TaKaRa) was performed ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated by template-switch reverse transcription according to the SMARTer RACE 5’/3’ manual using the SMARTScribe Reverse Transcriptase (Takara) with a template-switch oligo including an 18-nucleotide unique molecular identifier (UMI) ...
-
bioRxiv - Molecular Biology 2020Quote: ... To purify the probes, 1/3 of the transcription reaction was loaded on a pre-spun (700xg, 5minutes) Chromaspin-100 column (Clontech) and centrifuged (700g ...
-
bioRxiv - Neuroscience 2021Quote: ... three types of the GPR151 CDS-related inserts were sub-cloned into FUGW vector using In-Fusion Cloning kit (Takara, 638910). For control experimental sets ...
-
bioRxiv - Plant Biology 2024Quote: ... S1 and P1 fractions were loaded in denaturing buffer for SDS-PAGE separation and immunoblotted with the indicated antibodies (anti-DDB2: Molinier et al., 2008; anti-GFP: Takara-632593 ...
-
bioRxiv - Neuroscience 2021Quote: ... as described previously (Keith et al., 2012, Freund et al., 2016) with plasmids encoding green fluorescent protein (GFP) (pEGFPN1; Clontech), mouse Kif11 (Myers and Baas ...
-
bioRxiv - Neuroscience 2020Quote: ... The PCR fragment was then subcloned into the pCAG::myc-IRES-eGFP expression plasmid (Dimidschstein et al., 2013; Tiberi et al., 2012) by In Fusion cloning (Clontech). DNA fragment of pCAG::myc-tagged CROCCP2-IRES-eGFP was then amplified and cloned into lentiviral plasmid backbone (gift from Cecile Charrier ...
-
bioRxiv - Immunology 2020Quote: ... and cloned into full-length pTT3 derived IgL and IgK expression vectors (Snijder et al., 2018) or subcloned into the pT4-341 HC vector (Mouquet et al., 2010) using inFusion cloning (Clontech).
-
bioRxiv - Genetics 2020Quote: ... Three overlapping MTM1 cDNAs were amplified using three pairs of cDNA primers from Tosch et al(Tosch et al. 2010) using the PrimeSTAR GxL kit (Takara). Primers are F1/R1 (ATGGCTTCTGCATCAACTTC / TGGAATTCGATTTCGGGAC ...
-
bioRxiv - Immunology 2020Quote: The sequences of the A01 and A05 TCR were determined by a previously described 5’-rapid amplification of cDNA ends (5’RACE) based cloning strategy based on the manufacturer’s instructions (Yu et al., 2018; Jing et al., 2017) (Takara Bio, Japan). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... a loxP-GFPcaax-loxP fragment (Förster et al., 2017) and an epNTR-tagRFP fragment (Tabor et al., 2014) were inserted by In-Fusion cloning (Takara, Cat# 638909). Similarly ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Microbiology 2022Quote: ... the lentiviral transfer plasmid pCSII-EF-luciferase (Agarwal et al., 2006), and pCMV-VSV-G (Stewart et al., 2003) using the CalPhos Mammalian Transfection Kit (Takara Bio Company, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2021Quote: ... (ii) addition of a second adapter on the 3’ end of the cDNA during reverse transcription using SmartScribe RT (Clontech Biotechnologies, Mountain View, CA) as previously described (63) ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.5 μg of RNA was used for reverse transcription using the Reverse Transcription System (TaKaRa, RR036) according to the manufacturer’s protocol ...
-
bioRxiv - Pathology 2023Quote: ... Then reverse transcription reaction was conducted by means of TaKaRa reverse transcription reagents (TaKaRa, Dalian, China). The quantitative real-time polymerase chain reaction was performed using an SYBR Premix ...
-
bioRxiv - Immunology 2021Quote: ... For reverse transcription SmartScribe RT (Clontech) and corresponding buffer was used ...
-
bioRxiv - Microbiology 2021Quote: ... Then the Reverse Transcription Kit (Takara) was used to reversely transcribe RNA to cDNA ...
-
bioRxiv - Genetics 2024Quote: Transcription Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2022Quote: ... or NHE7 (Milosavljevic et al., 2014) (pIRES hygro vector, Clontech) were used to express these NHEs at the plasma membrane by repeated acute acidifications in the presence of 120 mM extracellular NaCl ...
-
bioRxiv - Neuroscience 2021Quote: ... total RNA was used for reverse transcription (RT) using the SMARTScribe Reverse Transcription Kit (TaKaRa, Cat #639537).
-
bioRxiv - Systems Biology 2023Quote: Molecular cloning was done by standard restriction enzyme digestion cloning, Gibson assembly (Gibson et al, 2009) or In-Fusion® cloning (Irwin et al, 2012) (TaKaRa Bio Inc., Kusatsu, Shiga, Japan). S ...
-
bioRxiv - Microbiology 2023Quote: ... and subsequently stained using a horseradish peroxidase (HRP)-conjugated monoclonal anti-StrepTag antibody (Iba) or mouse anti-6His (Clontech) monoclonal antibody combined with rabbit anti-mouse-HRP polyclonal antibodies (DAKO) ...
-
bioRxiv - Pathology 2024Quote: ... Reverse transcription was used to generate cDNA using a reverse transcription kit (Cat. no. RR037B, Takara, Dalian, China). Quantitative PCR was finally conducted using a SYBR kit (Cat ...
-
bioRxiv - Biochemistry 2021Quote: ... Reverse transcription kit was purchased from TaKaRa, Japan.SYBR Green PCR kit was purchased from American Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... Using the reverse transcription kit (TaKaRa, Japan) to get the cDNA in strict accordance with the steps in the experimental instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... A reverse transcription kit (Takara, Tokyo, Japan) was used as per the kit’s instructions to perform reverse transcription ...
-
bioRxiv - Immunology 2022Quote: ... In vitro Transcription T7 Kit (Takara, China) was used to synthesize specific siRNAs targeting the above genes according to the user’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... a reverse transcription kit (TaKaRa, Shiga, Japan) was applied to reverse transcribe 1000ng total RNA into cDNA ...
-
bioRxiv - Neuroscience 2023Quote: ... Reverse transcription was performed by adding 6uL of reverse transcription mixture (95U SMARTScribe Reverse Transcriptase (100U/uL, Clontech 639538), 10U RNase inhibitor (40U/uL) ...
-
bioRxiv - Cell Biology 2023Quote: ... pmCherry-C1(Picard et al., 2006) and pEGFP-C1 (Clontech #6084-1) were used as respective vector control ...
-
bioRxiv - Molecular Biology 2020Quote: ... the cDNAs were produced using BioRad Reverse Transcription Kit (iScriptTM Reverse Transcription Supermix) or the PrimeScript RT reagent kit (RR037A, TaKaRa). cDNAs from HEK and THP89 cells were quantified by quantitative PCR using Bio Rad’s SsoAdvanced Universal SYBR Green Supermix ...
-
bioRxiv - Neuroscience 2022Quote: ... The reverse transcription kit was purchased from Takara-Clontech (6210A ...
-
bioRxiv - Microbiology 2020Quote: ... reverse transcription (PrimeScript™ RT reagent Kit, Takara) and to remove genomic DNA (TURBO DNA-free kit ...
-
bioRxiv - Immunology 2021Quote: ... After reverse transcription (PrimeScript RT reagent kit, Clontech), real-time polymerase chain reaction was performed with the 7900HT Sequence Detection System (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... cDNAs were synthesized with reverse transcription kit (TaKaRa) with oligo d(T ...
-
bioRxiv - Cancer Biology 2024Quote: ... using a reverse transcription kit (Takara, Dalian, China) transcribe RNA into cDNA ...