Labshake search
Citations for Takara Bio :
1 - 50 of 344 citations for Dig 6C SAH 1a b c since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... AP20187 (B/B) compound (Takara Bioscience) was injected into the dorsal aorta through a small window made in the ventral egg ...
-
bioRxiv - Biophysics 2022Quote: ... B/B homodimeriser (AP20187, Takara Bio), dibenzocyclooctyne-PEG4-maleimide (760676 ...
-
bioRxiv - Neuroscience 2024Quote: ... B/B Homodimerizer (200nM, Takara, 635058), L-Glutamic acid (100-1,000μM ...
-
bioRxiv - Synthetic Biology 2022Quote: ... B/B dimerizer (AP20187 ligand; TaKaRa 635058) was added to a final concentration of 500 nM in the well ...
-
bioRxiv - Immunology 2022Quote: ... B/B homodimerizer (Takara Bio, Cat#635058), b-estradiol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... 500 nM B/B Homodimerizer (Takara, #635058) was also added ...
-
bioRxiv - Neuroscience 2023Quote: B/B homodimerizer was purchased from Takara USA lnc ...
-
bioRxiv - Pathology 2020Quote: AP21087 ((B/B homodimerizer, Takara Bio, CA, USA) was administered by intra-peritoneal (ip ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the pRep/Cap 1A-MYO capsid vector 56 into AAVpro 293T cells (TaKaRa, 632273) using polyethylenimine (PEI ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 500 nM of the B/B dimerizer (TaKaRa 635058) was added 2 hours before the start of the assay (or an Ethanol vehicle control was added) ...
-
bioRxiv - Neuroscience 2022Quote: ... AP20187 (B/B) (Clontech, Saint-Germain-en-Laye France) was added 4 h post-transfection overnight.
-
bioRxiv - Molecular Biology 2023Quote: ... and mmpL3 were amplified from Mtb H37Rv genomic DNA by PCR and inserted into pGW1-6C (gift of Tom Alber, University of California, Berkeley) by InFusion (Takara Bio) for wild-type genes or by ligation for recoded gene variants using restriction sites SpeI and NdhI ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.0 μl of 25mM B/B (in DMSO) (AP20187, Takara) was added to 50ul of PGCs (3,000 PGCs/μl ...
-
bioRxiv - Genetics 2020Quote: ... 1.0 ul of 25mM B/B (in DMSO) (Takara Bio) was added to 50ul PGC suspension before injection and subsequently 50 μl 300ul P/S (containing 30ul of 0.5mM B/B drug ...
-
bioRxiv - Biochemistry 2021Quote: ... After 16 hours of incubation with B/B homodimerizer (Takara Bio, 635059) at various concentrations ...
-
bioRxiv - Immunology 2022Quote: ... cells were stimulated with indicated concentrations of B/B homodimerizer (Takara Bio) for 15 h ...
-
bioRxiv - Neuroscience 2023Quote: ... the designed drug AP20187 (AP; B/B Homodimerizer purchased from Takara #635058) was first prepared according to manufacturer’s directions in 100% ethanol ...
-
bioRxiv - Cancer Biology 2024Quote: ... animals were ad- ministered 10 mg/kg B/B homodimerizer (AP20187; Clontech) diluted in 4% ethanol ...
-
bioRxiv - Cell Biology 2024Quote: ... in combination with either DMSO or 50 nM B/B homodimerizer (Clontech). After 30 minutes of treatment ...
-
bioRxiv - Cell Biology 2021Quote: ... Aggregates were formed by addition of 500nM rapalog2 (Takara, B/B homodimerizer #635059) for 1 h ...
-
bioRxiv - Biophysics 2023Quote: ... Pyroptosis was induced by addition of 500nM B/B-Homodimerizer (Takara Bio, AP20187) at 37°C and 5% CO2 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were exchanged with fresh media containing B/B homodimerizer (500nM) (Takara Bio, #635059) and/or Baf-A1 (100nM ...
-
bioRxiv - Neuroscience 2021Quote: ... The cDNAs encoding full-length human HCN1 channel and mouse TRIP8b (splicing variant 1a-4) were cloned into the pcDNA 3.1 (Clontech Laboratories) mammalian expression vector ...
-
bioRxiv - Molecular Biology 2021Quote: Genes of interest were amplified from genomic DNA of W303-1A and cloned into the respective vector using the In-Fusion HD cloning kit (Clontech). Mutations and deletions were introduced by oligonucleotide-directed site-specific mutagenesis.
-
bioRxiv - Cancer Biology 2024Quote: ... Programed cell death was induced by incubating cells in complete DMEM with 1 mM B/B homodimerizer (Clontech) for 15 min at 37°C ...
-
bioRxiv - Cancer Biology 2024Quote: RNA from of normal Human B and B lymphoma cells was isolated (NucleoSpin® RNA kit, #740984.50, Takara), cDNA was prepared (FSQ#201 ...
-
bioRxiv - Immunology 2024Quote: Ripk3-2XFVfl/fl Aldh1l1 Cre+ mice and Cre− littermate controls were treated intraperitoneally with B/B Homodimerizer (Takara, #AP20187) for 24 hours prior to perfusion with PBS and harvesting of whole brain ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Developmental Biology 2024Quote: ... to remove endogenous germ cells in the host chicken embryos 1.0 μl of 25 mM B/B (in DMSO) (Takara Bio) was added to 50 μL PGC suspensions before injection ...
-
bioRxiv - Synthetic Biology 2023Quote: ... T cells were incubated at 3×104 cells/well in 96-well U bottom plates for 24 hours in T cell media containing 50 IU/mL rhIL-2 and varying concentrations of AP20187 (B/B homodimerizer, Takara, 635058). After 24 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... cultivated in mTESR1 and grown 48hrs before functionality of the suicide gene was assessed by adding the chemical inducer of dimerization (CID) (AP20187, B/B Homodimerizer, Clontech Laboratories, Inc), or AP1903 ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... 86% of 2% Tween 20 in deionized Water) or AP20187 (B/B homodimerizer, Clontech; 10 mg of AP20187 per kg body mass) twice weekly at the age of 20 months for a total of 4 months (old mice were sacrificed at 24 months of age) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 12 µg RetroNectin solution (TaKaRa Biomedicals, cat# T100A/B) in PBS was added to each well of untreated 6-well plates (Greiner ...
-
bioRxiv - Biochemistry 2024Quote: ... PDIA6 domains (a0, a, b) and mutants (a0-A5, b-ND) were constructed using a PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Shiga, Japan). All PDIs used in this study were overexpressed in the Escherichia coli strain BL21 (DE3 ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were treated with 100ug/mL hygromycin B (Takara bio 631309). Cells were exposed to 100ug/mL hygromycin B for 8 days ...
-
bioRxiv - Immunology 2020Quote: ... plates were coated with 40 μg/mL retronectin (TAKARA, # T100A/B) overnight at 4°C ...
-
bioRxiv - Immunology 2022Quote: ... The SMARTer Mouse TCR a/b Profiling Kit (Takara, Cat. No. 634403) was used to amplify both TCRα and TCRβ sequences ...
-
bioRxiv - Microbiology 2023Quote: ... and MS4 (feline B-cell lymphoma) (73) using an RNAiso Plus kit (Takara), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... We used the DNA Single Index Kit – 12S Set A or B (TaKaRa) for indexing according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... rapalog (A/C Heterodimerizer, Takara), dynapyrazole A (Sigma-Aldrich) ...
-
bioRxiv - Immunology 2024Quote: cDNA was amplified from singly sorted B cells using SMART-Seq v4 (Takara Bio) at half reaction volumes ...
-
bioRxiv - Cell Biology 2022Quote: ... 200 μM A/C heterodimerizer (Takara) or ethanol control ...
-
bioRxiv - Neuroscience 2020Quote: ... Rapalog (A/C Heterodimerizer, TaKaRa, #635056) was added manually to a concentration of 100 nM to the cell medium ...
-
bioRxiv - Neuroscience 2020Quote: ... rapalog (A/C Heterodimerizer, TaKaRa, #635056) was added at a final concentration of 100 nM.
-
bioRxiv - Cancer Biology 2023Quote: ... were fused to GFP-C (Clontech). mCherry LEGO-C2 was provided by Dr ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Cell Biology 2023Quote: ... hygromycin B (300 µg/ml) and 10% tetracycline free fetal bovine serum (Takara Bio, USA) in a humidified incubator at 37°C in 5% CO2 in 6-well plates ...