Labshake search
Citations for Takara Bio :
501 - 550 of 958 citations for Dengue Virus Serotype 3 DIII envelope protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Products with 3’-dA overhangs were cloned into T-Vector pMD19 (Simple) (Takara Bio Inc., Shiga, Japan) to use as a template for sequencing.
-
bioRxiv - Plant Biology 2023Quote: ... histidine and adenine (-LTHA) as described in the Matchmaker™ GAL4 Two-Hybrid System 3 manual (Clontech). To overcome auto-activation from some of the constructs ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Biophysics 2019Quote: ... the detergent-solubilised protein were batch bound to Co2+-charged Talon resin (Clontech) by gentle rotation at 4 °C for 1 h ...
-
bioRxiv - Systems Biology 2021Quote: ... the inducible fluorescent protein was induced by adding 1 μg/ml doxycycline (Clontech) alone or together with 100 nM rapamycin (Harveybio ...
-
bioRxiv - Neuroscience 2021Quote: ... the fluorescent proteins were amplified from pAM FLEX eGFP and pmCherry-C1 (Clontech) respectively ...
-
bioRxiv - Cell Biology 2021Quote: ... 6xHis tagged proteins were purified using Talon Co2+ affinity resin (Takara Bio, USA) and eluted with 150 mM Imidazole in the lysis buffer pH 7.8 ...
-
bioRxiv - Microbiology 2021Quote: ... The protein bands were visualized using the Western BLoT Hyper HRP Substrate (TAKARA) and exposed using a Chemiluminescence Imaging System (Fusion Solo S ...
-
bioRxiv - Cell Biology 2022Quote: Every protein expressed in mouse rods was also cloned into pEGFP-N1 (Clontech) for expression in AD293 cells using the AgeI and NotI cloning sites within the vector to replace EGFP with the tagged proteins ...
-
bioRxiv - Plant Biology 2020Quote: ... Transferred proteins were first probed with anti-GFP (Takara Bio, 1:5,000 dilution) for 16 h ...
-
bioRxiv - Biochemistry 2021Quote: ... The recombinant proteins were purified with His60 Ni Gravity Column Purification Kit (Clontech) following a manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... the Rab8A proteins were co-expressed with the chaperone GroEL/S (pGro7, Takara). The expression of the GroEL/S chaperone was auto-induced by supplementing the LB-medium with 1 mg/mL arabinose.
-
bioRxiv - Biochemistry 2021Quote: ... Proteins in the supernatant were purified by the affinity chromatography with TALON (Clontech) resin ...
-
bioRxiv - Cell Biology 2020Quote: ... Shield-1 ligand for stabilization of DD-tagged proteins was purchased from Takara Bio (Cat # 632189 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Monoclonal U-2OS cell lines stably expressing Tet-On 3G transactivator protein (Clontech), a tandem-dimeric MS2 hairpin binding protein tagged with eYFP (MS2CP-YFP) ...
-
bioRxiv - Cell Biology 2023Quote: For mammalian expression of eGFP labelled proteins we used the pEGFP-C1 (Clontech) vector ...
-
bioRxiv - Developmental Biology 2023Quote: ... which was induced for protein purification using Talon Metal Affinity Resin (Takara 635501). Two New Zealand white rabbits were injected at ten sites with 500μl of Freund’s Complete Adjuvant (Sigma-Aldrich F5881 ...
-
bioRxiv - Biochemistry 2023Quote: ... MA) and the protein was purified using Talon beads (Takara Bio Inc., Japan) following published protocols 37,38 ...
-
bioRxiv - Cell Biology 2023Quote: ... for GST-tagged protein or on TALON-Cobalt beads column (635507, Takara Bio) for 6XHIS-tagged protein as previously described [19,26] ...
-
bioRxiv - Neuroscience 2023Quote: ... the fluorescent proteins were amplified from pAM FLEX eGFP and pmCherry-C1 (Clontech) respectively ...
-
bioRxiv - Plant Biology 2024Quote: ... The JMJ27-GFP fusion protein was detected using the anti-GFP (Takara: 632593) 1:2,000 (v ...
-
bioRxiv - Microbiology 2024Quote: ... The fusion protein was affinity-purified using TALON metal affinity resin (Takara Biosciences) and eluted in buffer containing 50 mM Tris-HCl ...
-
bioRxiv - Cell Biology 2020Quote: ... and the 3’- M6 fragment and the sfGFP fragment were inserted using In-fusion cloning (homologous recombination; TaKaRa). The resulting M6-sfGFP insert was excised using NotI and KpnI and ligated into pUASt-attB [38] ...
-
bioRxiv - Developmental Biology 2021Quote: ... and 3⍰×⍰105 cells were reverse transfected with 2μg of UniSAM DNA using the Xfect Transfection reagent (Clontech) and plated into a coated 6 well plate ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)20nm -EGFP-FKBP12.
-
bioRxiv - Biochemistry 2020Quote: ... These 3 fragments were inserted between the KpnI site and the NheI site in pPBH-TREtight by Clontech In-Fusion® Cloning Kit to get pPBH-TREtight-FRB-eDHFR-(ER/K)30nm-EGFP-FKBP12.
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... 3 μl of each dilution was then spotted on a SD-Leu-Trp plate (ST0048, Takara Bio, USA) as a growth control ...
-
bioRxiv - Cancer Biology 2020Quote: ... After incubation membrane was washed with 1X TBST buffer 3 times and detected with ECL reagent (TAKARA, Japan) using Versa Doc (BD Bioscience ...
-
bioRxiv - Molecular Biology 2022Quote: ... A 25 nt poly(A) sequence was inserted after the 3’ UTR using the In-Fusion (Takara Bio) method.
-
bioRxiv - Cell Biology 2022Quote: ... Flt3 ligand (50 ng/ml) and IL-3 (20 ng/ml) onto plates coated with retronectin (Takara Bio).
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2022Quote: ... and in-chip reverse transcription PCR were performed using a 3’ DE Chip and Reagent kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Bioengineering 2024Quote: ... CD11b-specific amplicons were generated via 3-step nested PCR using PrimeSTAR GXL (Takara Bio, Kusatsu, Shiga, Japan) according to the manufacturer’s protocol with a 60°C annealing temperature ...
-
bioRxiv - Cancer Biology 2024Quote: ... Retroviral transduction was achieved by spinoculation of 3 × 106 mouse T cells on retronectin-coated plates (Takara Bio) with neat retroviral supernatant harvested from 293T packaging cells (2000xg ...
-
bioRxiv - Plant Biology 2024Quote: ... and inserted into BamHI-digested pGEX-4T-3 by using In-Fusion Smart Assembly Cloning Kit (Takarabio-Clontech). Full-length OcKSL4 cDNA was amplified by RT-PCR using primers 5’-GGATCCATGGCGAATTATCCCATGGAG-3’ (forward ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Cell Biology 2020Quote: ... HIS-Ub-conjugated proteins were purified by cobalt chromatography (TALON metal affinity resin, Clontech), as described in the manual ...
-
bioRxiv - Biophysics 2019Quote: ... 300 ng of the plasmid encoding the green fluorescent protein (pEGFP, Clontech, CA, USA) and 12 μL of Lipofectamine/Plus reagent ...
-
bioRxiv - Biochemistry 2021Quote: ... monoclonal antibody for green fluorescent protein (JL-8; Takara Bio, Kusatsu, Japan; recognizes VC), rabbit anti-GFP (D5.1 Cell Signaling Technology 2956S ...
-
bioRxiv - Plant Biology 2022Quote: ... CITRINE-fusion proteins were detected with anti-GFP antibody (JL-8, Takara Bio Clontech, dilution ...
-
bioRxiv - Microbiology 2021Quote: ... The protein was purified from the supernatant by TALON metal affinity resin (Clontech, #635606) and eluted with 150 mM imidazole ...