Labshake search
Citations for Takara Bio :
651 - 700 of 2480 citations for Dengue Virus Serotype 2 NS1 Protein Insect Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... After 12 h medium was collected and recombinant proteins were purified on TALON metal affinity resin (Takara). 200 μl of the resin was loaded onto 1 ml column (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... The concentration of the purified protein was assessed by densitometry using bovine serum albumin (TaKaRa, cat. # T9310A) as a standard following SDS-PAGE and staining with the Q-stain ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs encoding for sequences of proteins of interest were amplified and inserted into pEGFP-N1 vector (Clontech). Each DNA construct was checked by conventional Sanger sequencing of purified plasmid.
-
bioRxiv - Bioengineering 2024Quote: ... All proteins were purified with a Talon metal affinity resin (Takara Bio USA, Mountain View, CA, USA) and dialyzed against pyrogen-free PBS ...
-
bioRxiv - Physiology 2023Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line; Takara # 632273) in DMEM (SH30022.01 ...
-
bioRxiv - Physiology 2024Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line; Takara # 632273) in DMEM (SH30022.01 ...
-
bioRxiv - Cancer Biology 2021Quote: ... relative cell mass was assessed using WST-1 Cell Proliferation Reagent (Clontech) per manufacturer’s instruction ...
-
bioRxiv - Cancer Biology 2019Quote: ... embryonic kidney cell line HEK293(ATCC CRL-1573) and 293GP cells (Clontech) were cultured in high glucose (5g/l ...
-
bioRxiv - Molecular Biology 2023Quote: ... The cells were lysed with the xTractor Bacterial Cell Lysis Buffer (Clontech) and sonicated ...
-
bioRxiv - Physiology 2023Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line ...
-
bioRxiv - Physiology 2024Quote: Approximately 70-80% confluent HEK293T cells (AAVpro® 293T Cell Line; Takara # 632273 AAVpro® 293T Cell Line ...
-
bioRxiv - Physiology 2020Quote: ... coli Stellar cells (Clontech/Takara Bio USA Inc. ...
-
bioRxiv - Cell Biology 2021Quote: ... 293-LVX cells (Clontech) were transfected with pMSCV and pCl-Eco plasmids using Lipofectamine 3000 (Invitrogen ...
-
bioRxiv - Bioengineering 2019Quote: ... coli cells (Stellar, TaKaRa) were used for all cloning steps and were grown in LB medium supplemented with antibiotics as required - ampicillin (100 μg/mL) ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa), grown in LB medium at 37 °C ...
-
bioRxiv - Microbiology 2019Quote: ... coli cells (Stellar, TaKaRa). A synthetic version of the E ...
-
bioRxiv - Biochemistry 2021Quote: ... coli cells (Takara Bio) and positive clones were identified via RFP selection before sequencing to confirm the cloning was successful.
-
bioRxiv - Microbiology 2022Quote: ... coli Stellar cells (Takara) for non-R6K origin of replication-based vectors or PIR2 cells (Invitrogen ...
-
bioRxiv - Genomics 2022Quote: ... coli cells (Takara Bio) and plasmid was prepared following standard protocols ...
-
bioRxiv - Microbiology 2022Quote: HEK 293T cells (Clontech) and its derivative ...
-
bioRxiv - Genomics 2023Quote: ... coli cells (Takara Bioscience). Sanger sequencing (Genewiz ...
-
bioRxiv - Microbiology 2023Quote: AH109 yeast cells (Clontech) were used for yeast two-hybrid experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... HeLa TetOn3G cells (Takara) were co-transfected with the tet-L1/GLucAI donor plasmid (pBH201 ...
-
bioRxiv - Microbiology 2023Quote: ... coli Stellar cells (Clontech) and plated onto Luria Bertani agar supplemented with 25 µg/ml chloramphenicol ...
-
bioRxiv - Synthetic Biology 2023Quote: ... HEK293 cells (Takara 632180), C3H/10T1/2 Clone 8 (ATCC# CCL-226) ...
-
bioRxiv - Cell Biology 2023Quote: ... Lenti-X cells (Clontech) were transfected with pMD2.G (addgene #12259) ...
-
bioRxiv - Cell Biology 2023Quote: ... LX-293T cells (Takara) were seeded into 6-well plates and grown till 80% confluence was reached ...
-
bioRxiv - Genomics 2024Quote: ... Stellar competent cells (Takara) were used for transformation and downstream miniprep (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... into LentiX-cells (Takara) according to standard procedures ...
-
bioRxiv - Synthetic Biology 2024Quote: ... LentiX cells (Takara 632180) were used to produce lentivirus ...
-
bioRxiv - Microbiology 2021Quote: ... were transduced into TCR-deficient Jurkat cells or primary T-cells using the Plate-GP and PG13 cell-based retrovirus system and Retronectin (Takara Bio) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Neuroscience 2021Quote: ... Sections were then stained using primary antibodies against the reporter proteins mCherry (Clontech 632543 RRID: AB_2307319, 1:250) and against the panneuronal marker NeuN (millipore MAB377 RRID ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Plant Biology 2020Quote: ... GFP-TSN-interacting proteins and native TSN were detected by mouse α -GFP (monoclonal antibody JL-8; Clontech) and rabbit α-TSN antibodies at final dilutions of 1:1,000 and 1:5,000 ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Developmental Biology 2022Quote: ... The expression of Dunk protein was confirmed by Western blot using c-Myc Monoclonal Antibody (Takara, Cat# 631206). Then ...
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Microbiology 2022Quote: ... The coding sequence of enhanced green fluorescent protein (eGFP) was amplified from plasmid eGFP-C1 (6084-1, Clontech) using primers eGFPN-F/eGFPN-R ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...