Labshake search
Citations for Takara Bio :
1 - 50 of 1451 citations for DIRAS Family GTP Binding RAS Like 1 DIRAS1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Additional to the NF-κB binding motifs NF-κB response element and a TATA-like sequence from pNFκB-Luc vector (Clontech Cat. No. 631904) were added to the Firefly luciferase gene and introduced into pCDH-CMV-EF1-Puro.
-
bioRxiv - Plant Biology 2023Quote: ... and a rabbit LexA binding domain antibody (Clontech), respectively.
-
bioRxiv - Physiology 2022Quote: ... The insulin-like growth factor 1 (IGF1) coding sequence was PCR amplified (CloneAmp, Takara Bio; Cat. No. 639298) from cDNA generated from a rat gastrocnemius muscle ...
-
bioRxiv - Plant Biology 2019Quote: ... western blot and immuno-detection using monoclonal antibodies raised in mouse against the GAL4 activation or binding domain (1:10000 dilution, Clontech, www.clontech.com) following the Matchmaker Monoclonal Antibodies User Manuel from Clontech ...
-
bioRxiv - Neuroscience 2021Quote: The 5’UTR promoter region of mouse L1Spa belonging to LINE-1 Tf family was amplified with the primers (Fw; AATGGGCAGAGCTCGTTTAG, Rv: CTGGTAATCTCTGGAGTTAG) and Takara LA Taq polymerase with GC buffer (Takara Bio) using pTN201 plasmid (a kind gift from Dr ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The recombinant Irg1-like protein was enriched using cobalt TALON Metal Affinity Resin (Takara Bio #635501) with gentle shaking for 1 hour at 4 ℃ and washed twice by centrifugation for 3 minutes at 3500 rpm at 4 ℃ and resuspension in the washing buffer (20 mM Tris pH 8.0 ...
-
bioRxiv - Molecular Biology 2019Quote: ... the MS2 binding sites were amplified with primer pair 1 (Supplementary File 1: Table S4) and cloned into pEGFP-C1 (Clontech) as EcoRI/BamHI fragment ...
-
bioRxiv - Neuroscience 2023Quote: ... Constructs containing point-mutated ARE-like sequences were prepared using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Shiga, Japan). Because an ARE half-site can function alone to confer androgen inducibility (Pihlajamaa et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... The sequence encoding mCherry in frame with the polybasic sequence and CAAX motif of human K-Ras (GKKKKKKSKTKCVIM) for targeting to the plasma membrane was generated by amplification of mCherry using the pmCherry-N1 (Clontech) plasmid as template and the following primers ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... magnanima was assessed by PCR amplifying a cifB-like gene (Extended Data Table 3) in the WOwHm-t76 region with the Emerald Amp Max Master mix (TaKaRa) at 94°C for 3 min ...
-
bioRxiv - Plant Biology 2019Quote: The full-length cDNA of NaERF2-like with two HA flags was cloned into pCAMBIA1301 vector after 35S promoter via in-fusion technique (Clontech). N ...
-
bioRxiv - Molecular Biology 2023Quote: ... flanking the site of alterations (HDE-like motifs) were amplified from the genomic DNA using CloneAmp HiFi PCR Premix (Clontech), A-tailed with DreamTaq DNA polymerase and ligated into pGEM-T Easy vector ...
-
bioRxiv - Systems Biology 2023Quote: ... The generated PCR products for the full-length proteins were transferred into the pMET7-GAG-sp1-RAS plasmid by classic cloning with restriction enzymes (EcoRI and XbaI) or In-Fusion seamless cloning (Takara Bio) when the genes contained internal restriction sites for EcoRI and XbaI (which was the case for CSDE1 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the coding region of RAS cDNA was first PCR-amplified from the plasmids above by using CloneAmp HiFi PCR Premix (Takara #639298) and the primers listed in Supplementary Table 3 using manufacturer’s recommended PCR conditions ...
-
bioRxiv - Biophysics 2020Quote: ... The complex was then purified by binding on Talon resin (Clontech) and eluted in 150 mM imidazole ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:4 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 2 and 10 column volumes of Membrane Buffer 2 with 20 mM imidazole before elution with Membrane Buffer 2 with 300 mM imidazole ...
-
bioRxiv - Cell Biology 2021Quote: α-His primary antibody (1/10,000; Clontech) and HRP-conjugated goat anti-mouse IgG (H+L ...
-
bioRxiv - Cell Biology 2021Quote: ... For iPSC-O differentiation to hepatocyte-like cells (HLC-O): Hepatic differentiation of iPSC-O was performed by Cellartis Hepatocyte Differentiation Kit (Y30050, Takara Bio, Shiga, Japan) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2024Quote: ... Each half-site of the responsible ERE-like sequence was mutated into a HindIII recognition site using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Shiga, Japan). Transcriptional activity assays with these constructs were done as described above ...
-
bioRxiv - Plant Biology 2020Quote: ... βC1 was fused with binding domain and cloned into pGBKT7 BD (Takara Bio). Plasmids were transformed into AH109 strain as described previously (Gietz and Woods ...
-
Targeted attenuation of elevated histone marks at SNCA alleviates α-synuclein in Parkinson’s diseasebioRxiv - Neuroscience 2020Quote: ... Anti-Cas9 antibody (Takara, 632607; 1:1000) and anti-GFP antibody (Fisher Scientific ...
-
bioRxiv - Plant Biology 2021Quote: ... GFP monoclonal antibody (Takara, # 632375; 1:2,000), Bip2 antibody (Agrisera ...
-
bioRxiv - Molecular Biology 2022Quote: ... anti-GFP antibody (Clontech, rabbit, 1:2000), anti-Ago1 antibody (Abcam ...
-
bioRxiv - Microbiology 2023Quote: ... monoclonal antibody (cat # 632380, 1: 2,000, Clontech) and horseradish peroxidase (HRP)-labeled anti-mouse IgG (H + L ...
-
bioRxiv - Genomics 2023Quote: ... Antibody list: FOXG1 (rabbit, 1:200, Takara) and PAX6 (mouse ...
-
bioRxiv - Cell Biology 2023Quote: ... E-cadherin antibody (HECD-1, 1:1000 IF, 1:1000 WB) was from Takara Bio ...
-
bioRxiv - Immunology 2019Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2022Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% NDS ...
-
bioRxiv - Neuroscience 2021Quote: ... rabbit anti-DsRed antibodies (1:3000, Takara, 632496). Sections were washed three times in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies used: DsRed (Rabbit, 1:2000, Clontech), VGLUT1 (Guinea Pig ...
-
bioRxiv - Immunology 2022Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), rabbit anti-Lcp1 (1:1000) ...
-
bioRxiv - Developmental Biology 2020Quote: ... rabbit anti-DsRed polyclonal antibody (1:500; Clontech), Alexa Fluor 488-conjugated anti-chicken IgG antibody (1:500 ...
-
bioRxiv - Neuroscience 2021Quote: ... hNSC antibody (SC121, 1:100; Takara: Cat #: Y40410) and vGlut 1 (vesicular glutamate transporter 1 ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-mCherry antibodies (Clontech; 1:2000) in PBST-azide with 3% normal donkey serum ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6xHN Polyclonal Antibody (1:2000, Takara, CA, USA) at 4°C for overnight ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
Mis6/CENP-I maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosisbioRxiv - Cell Biology 2021Quote: ... the rabbit anti-RNA polymerase II (phosphoS5) polyclonal antibody (1:100; ab5131) or rabbit anti-GFP polyclonal antibody (1:250; Clontech, 632592) was incubated with 200 µL of the lysate for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... and Lamin (LAM) were cloned into the DNA-binding domain vector pGBKT7 (Clontech Matchmaker System). The full-length open reading frame of NAA50 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The RNA-binding protein expressing vector was based on the shuttle vector pGADT7 (Clontech, USA) and constructed as described previously [25] ...
-
bioRxiv - Biochemistry 2023Quote: ... The His-tagged TEV protease was removed by binding to Co2+-charged TALON resin (Clontech) and the flow-through concentrated using a 100 kDa molecular weight cut off concentrator (Corning) ...
-
bioRxiv - Neuroscience 2021Quote: ... or monoclonal mouse anti-GFP antibody (1:1000, Clontech). Membranes were then washed and incubated with horseradish peroxidase-conjugated anti-chicken ...
-
bioRxiv - Developmental Biology 2021Quote: ... stained with anti-GFP antibody (1/800, 632592, Clontech) and biotinylated anti-rabbit IgG (1/200 ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse anti-STEM101 antibody (Takara Bio Inc., 1:100) to stain for transplanted human NPCs ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... Primary antibodies against mCherry (Mouse, Clontech, 632543; 1/500), GFP (rabbit polyclonal anti-GFP ...
-
bioRxiv - Neuroscience 2020Quote: ... Rabbit anti-DsRed antibody (Clontech, 632496, 1:100 dilution), Guinea pig anti-Period antibody (Gift from Amita Sehgal ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary Antibodies: anti-GFP (JL-8; Clontech, 1:1000), anti-Flag (Sigma-Aldrich ...
-
bioRxiv - Pathology 2022Quote: ... Primary antibodies: rabbit anti-DsRed express (Clontech, 1:250) and goat anti-HRP (Jackson Lab ...
-
bioRxiv - Neuroscience 2023Quote: ... rabbit anti-DSred primary antibody 1:500 (Takara, 632496) which binds Td-tomato protein ...