Labshake search
Citations for Takara Bio :
1 - 50 of 900 citations for D Ribitol 5 Phosphate Cytidylyltransferase ISPD CRPPA Antibody since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with D/D-Solubilizer (5 μM, Clonetech/Takara) and Cycloheximide (35.54 μM ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Genomics 2023Quote: ... using calcium-phosphate (Takara). Media was changed at 24 hours and samples were collected 72 hours post-transfection.
-
bioRxiv - Synthetic Biology 2020Quote: ... The deletion of the lacZ gene was verified using blue-white selection on an LB agar plate containing 0.1 mM isopropyl-β-D-thiogalactopyranoside (Nacalai Tesque) and 4.0 × 10−3 % 5-bromo-4-chloro-3-indolyl-β-D-galactoside (Takara Bio).
-
bioRxiv - Neuroscience 2020Quote: ... a Calcium Phosphate Transfection kit (Clontech) was used to transfect cells with a mixture of OXTR-iTango2 DNA plasmid vectors with a secreted alkaline phosphatase (SEAP ...
-
bioRxiv - Immunology 2024Quote: ... containing 0.5 ml of a 1:1 solution of phosphate-buffered saline (PBS):FBS supplemented with ribonuclease inhibitor (1:100; Takara Bio). For some samples ...
-
bioRxiv - Cell Biology 2022Quote: ... D/D solubilizer (635054) from Takara, VECTASHIELD Mounting Medium (H-1400 ...
-
bioRxiv - Bioengineering 2022Quote: ... were transiently transfected using calcium phosphate (Takara) and retrovirus-containing supernatants were collected 2 days later ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were then blocked in 5% Skim milk powder (Fujifilm, Cat# 190-12865) mixed with Phosphate buffered saline with tween® (PBS-T) (Takara, Cat# T9183). The chosen primary antibody was then incubated overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were blocked in 5% Skim milk powder (Fujifilm, Cat# 190-12865) with Phosphate buffered saline with tween® (PBS-T) (Takara, Cat# T9183). The primary antibody was incubated overnight at 4°C ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Cell Biology 2020Quote: ... D/D solubilizer were purchased from Clontech. Methyl-β-cyclodextrin and 2-hydroxypropyl-β-cyclodextrin were purchased from Wako Chemicals ...
-
bioRxiv - Cell Biology 2020Quote: ... pre-equilibrated with phosphate-buffered saline (PBS; TAKARA). After the addition of the reaction mixture (100 μL ...
-
bioRxiv - Cell Biology 2022Quote: ... and preserved in phosphate-buffered saline (PBS; TaKaRa) at 4 °C until use ...
-
bioRxiv - Neuroscience 2024Quote: ... dissolved in phosphate-buffered saline (PBS; #T9181, Takara) was placed onto the gap created by removing flagellum ...
-
bioRxiv - Neuroscience 2024Quote: ... using a calcium phosphate transfection kit (Takara #631312). The cell culture supernatant was collected at 48 hours post-transfection using centrifugation at low speed (1500×g ...
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2023Quote: 1.0 μM of D/D solubilizer (Takara, Cat: # 635054) in Opti:MEM® (Gibco ...
-
bioRxiv - Plant Biology 2023Quote: ... and SD4 (-Trp-Leu-His-Ade) media at 30℃ for 3–5 d according to the manufacturer’s manual (Clontech).
-
bioRxiv - Cell Biology 2022Quote: ... HEK-293T cells were transfected with calcium phosphate (Clontech) in T75 flasks using a total of 30 μg plasmid DNA ...
-
bioRxiv - Biophysics 2021Quote: ... using the calcium phosphate method (Takara Bio, Shiga, Japan). All animal experiments complied with the protocols approved by the Institutional Animal Care and Use Committee of Tohoku University (2016EgA-003 ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 μL of treated RNA was reverse transcribed using oligo d(T) primers (PrimeScript RT Reagent Kit, Takara Bio, Kyoto Japan). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... pupal wings were fixed in PBS (phosphate buffered saline, Takara Bio) with 4% paraformaldehyde (PFA ...
-
bioRxiv - Synthetic Biology 2023Quote: ... in 1x Phosphate-buffered saline (PBS) (Takara #T9181 or Gibco #70011044) was added to each well such that the liquid could cover the entire surface and be aspirated after one hour at 37°C before plating cells ...
-
bioRxiv - Immunology 2021Quote: ... pMD2.G and the CAR-expression plasmid by calcium phosphate transfection (Clontech). At 16 hrs post-transfection cells were washed with PBS and incubated in complete DMEM media containing 6 mM sodium butyrate (Sigma Aldrich) ...
-
bioRxiv - Neuroscience 2021Quote: ... was dissolved in phosphate buffered saline (PBS) (T900, Takara BIO Inc, Japan)13 ...
-
bioRxiv - Genomics 2021Quote: ... by calcium phosphate transfection with CalPhos™ Mammalian Transfection Kit (Takara, 631312) following the manufacturer’s protocol into HEK293T cells ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were collected and suspended into phosphate-buffered saline (PBS) (Takara, T900) containing 20 mM imidazole (Nacalai Tesque ...
-
bioRxiv - Cell Biology 2023Quote: ... Release of TfR from the ER was triggered by adding D/D solubilizer (Takara Bio) to the live-cell imaging solution at a final concentration of 1 µM.
-
bioRxiv - Genomics 2023Quote: ... 5 µm-thick sections were cut and immunostained with anti-GFP antibody (living colors, Clontech, 632592) and secondary anti-rabbit IgG with Alexa fluor 488 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2020Quote: PC4 cells (Gordon et al., 2017) were incubated with 0.5 µM D/D Solubilizer (Takara; 635054) in a time course-dependent manner ...
-
bioRxiv - Cell Biology 2021Quote: ... and the respective retroviral vector (pWPI) using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Molecular Biology 2021Quote: ... as internal control by the calcium phosphate transfection method according to the manufacturer’s protocol (Takara). Raji cells (3×106cells ...
-
bioRxiv - Cell Biology 2022Quote: ... the cultured neurons were transfected using the High-Efficiency Ca2+ Phosphate Transfection Kit (Takara Bio). Briefly ...
-
bioRxiv - Bioengineering 2023Quote: ... 661W cells were transfected with the calcium phosphate technique or the XfectTM transfection reagent (Takara). MEF cells were transfected using TurboFectTM Transfection Reagent (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2024Quote: Mice were anesthetized with isoflurane and perfused transcardially with 1X Phosphate Buffered Saline (PBS) (Takara) and 4% Paraformaldehyde (PFA ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Neuroscience 2024Quote: ... HEK293 cells were first incubated with ARIAD ligand at a concentration of 1 µM (AL; D/D Solubilizer; Takara) for the indicated times ...
-
bioRxiv - Microbiology 2021Quote: ... P3 and NP from D/660 and D/CN286 were amplified from the respective bidirectional pHW2000 plasmid constructs using CloneAmp Hifi PCR mix (Takara) with the following cycle profile ...
-
bioRxiv - Cell Biology 2020Quote: ... generates a protein that undergoes spontaneous aggregation that reverses upon the addition of D/D solubilizer (catalogue# 635054; Takara Bio), a cell-permeant rapamycin analog that binds to the FM4 domains (see Fig 3e).
-
bioRxiv - Neuroscience 2024Quote: Mice were anesthetized with isoflurane and perfused intracardially with 1X Phosphate Buffered Saline (PBS) (Takara, Japan) and 4% Paraformaldehyde (PFA ...
-
bioRxiv - Neuroscience 2024Quote: Mice were anesthetized with isoflurane and perfused intracardially with 1X Phosphate Buffered Saline (PBS) (Takara, Japan) and 4% Paraformaldehyde (PFA ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Neuroscience 2020Quote: ... in a 100 mm dish using a calcium phosphate transfection kit (CalPhos Mammalian Transfection kit, Clontech, 631312). Two days post-transfection ...
-
bioRxiv - Cell Biology 2022Quote: ... 2019) and 10 fmol JF646-LANA (see below) in 0.5 nL phosphate-buffered saline (PBS, Takara, T900) containing 0.05% phenol red (SIGMA ...
-
bioRxiv - Neuroscience 2024Quote: ... was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
Orchestration of alternative splicing regulates bone marrow mesenchymal stem cells fate during agingbioRxiv - Cell Biology 2022Quote: ... bone sections were blocked in 5% bovine serum albumin (BSA) for 1 hour at room temperature and incubated with primary antibody to osteocalcin (Takara, M173) at 4°C overnight ...
-
bioRxiv - Biophysics 2022Quote: ... HEK-D (see below) and Lenti-X 293T (Takara) cells were cultured in growth medium consisting of Dulbecco’s modified Eagle’s medium (GIBCO) ...