Labshake search
Citations for Takara Bio :
51 - 100 of 5203 citations for Cyclic GMP Direct ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... The copy number of viral RNA was standardized with a SARS-CoV-2 direct detection RT-qPCR kit (Takara, Cat# RC300A). The fluorescent signal was acquired using a QuantStudio 3 Real-Time PCR system (Thermo Fisher Scientific) ...
-
bioRxiv - Microbiology 2022Quote: Total RNA was extracted from HT-29 cells using the CellAmp Direct RNA Prep Kit for RT-PCR (3732; TaKaRa, Japan) after the introduction of genomic DNA or Poly (I ...
-
bioRxiv - Biophysics 2024Quote: Lentivirus titration was determined by p24 ELISA using Lenti-X™ p24 Rapid Titer Kit (Takara Bio, no. 632200) and a plate reader (PerkinElmer Victor3 V) ...
-
bioRxiv - Microbiology 2019Quote: ... and 5’- or 3’-RACE was performed with SMARTer®RACE 5’/3’ Kit (Takara, 634858) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: The 5’ and 3’ RACE analyses were performed using the SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: 5’ RACE of lncRNA VILMIR was performed using the SMARTer RACE 5’/3’ Kit (Takara, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... Genotyping was performed using Terra PCR Direct Polymerase Mix (Takara) following manufacturers specifications.
-
bioRxiv - Microbiology 2024Quote: ... Genotyping was performed using Terra PCR Direct Polymerase Mix (Takara) following the manufacturer’s specifications ...
-
bioRxiv - Microbiology 2020Quote: ... and subsequently cellular RNA was extracted at 6 hpi using a CellAmp Direct RNA Prep Kit (3732, Takara Bio Inc., Shiga, Japan). The qRT-PCR assays were performed to quantify the amount of SARS-CoV-2 RNA with QuantStudio 3 instrument (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2021Quote: ... The number of SARS-COV-2 copies were quantified using Direct One-Step RT-qPCR Mix for SARS-CoV-2 kit (Takara Bio Inc.).
-
bioRxiv - Microbiology 2023Quote: ... The cells were cultured again overnight and subjected to the quantification of mRNA by qRT-PCR using the CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (3732, Takara Bio Inc.), One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Microbiology 2021Quote: ... The extracellular SARS-CoV-2 RNA in the culture supernatant was analyzed using SARS-CoV-2 direct detection RT-qPCR kit (RC300A; TaKaRa-Bio, Shiga, Japan). The infectivity of SARS-CoV-2 in the culture supernatants was determined at 48 h post-infection ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Microbiology 2019Quote: PCR were performed using the Terra PCR Direct Polymerase Mix (Clontech) directly on the cell lysates using the following primers:
-
bioRxiv - Microbiology 2019Quote: PCR were performed using the Terra PCR Direct Polymerase Mix (Clontech) directly on the cell lysates after each round of co-infection ...
-
bioRxiv - Genomics 2020Quote: ... cDNA was PCR-amplified using Terra PCR Direct Polymerase (Takara Bio). Final libraries were prepared using 1ng of cDNA per library with the Nextera XT kit (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 5’RACE was performed with SMARTer RACE 5’/3’ Kit (Takara Bio USA, Inc. San Jose, CA USA) according to the manufacturer’s directions.
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... we performed ELISA against HIV p24 (TaKaRa Clontech #632200) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... and titer quantified using p24 ELISA antigen assay (Takara). MOI=5 was used to transduce 1x1097 EndoC-βH3 cells in culture media without pen/strep and puromycin.
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Genetics 2019Quote: ... after a first step of Terra PCR Direct Polymerase Mix amplification (Takara) using one μl sample of total blood ...
-
bioRxiv - Genomics 2023Quote: ... a preliminary Terra PCR Direct Polymerase mix amplification (Takara Bio, Kusatsu, Japan) using 1µL of crude sample was used for direct genotyping without DNA purification ...
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
bioRxiv - Cancer Biology 2022Quote: The SMARTer RACE 5’/3’ Kit (Takara Bio, Catalog no 634860, USA) was used to perform both 5’- and 3’-rapid amplification of cDNA ends (RACE ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Plant Biology 2020Quote: ... which were produced using the 5’-SMART RACE cDNA amplification kit (CLONTECH), by PCR using primers (Smc6 ...
-
bioRxiv - Immunology 2019Quote: ... and cDNA prepared using the SMARTer RACE 5’/3’ Kit (Takara/Clontech). Samples were analyzed by 2×300 base pairs (bp ...
-
bioRxiv - Immunology 2020Quote: ... cDNA was generated via the Smarter 5’RACE cDNA amplification kit (Clontech) using 4.5μl mRNA input and following the recommended protocol ...
-
bioRxiv - Immunology 2021Quote: RACE-PCR was performed using the SMARTer 5’/3’ RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant (5 ml) was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and incubated for 4 h at 37°C ...
-
bioRxiv - Microbiology 2023Quote: ... a PCR test is performed using the Terra PCR Direct Polymerase Mix (Takara Bio Europe SAS ...
-
bioRxiv - Molecular Biology 2021Quote: ... the puromycin-selected transfectants were directly subjected to RT-qPCR analysis using the CellAmp™ Direct TB Green® RT-qPCR Kit (TaKaRa Bio Inc., Shiga, Japan) at 3 days after transfection ...
-
bioRxiv - Genetics 2021Quote: Adult ovary total RNA was used to amplify the 5’ and 3’ UTR of Pxmeiw68 and PxnanosP using the SMARTer RACE 5’/3’ Kit (Takara, Japan). 5’ and 3’ regulatory sequences were then cloned from 4th instar larval gDNA ...
-
bioRxiv - Biochemistry 2020Quote: ... The target 23-mer sequences for sgRNA used were 5’-TTTACCTTGATAGGTGGTAGTGG - 3’and 5’-ATAAAGAGAGGCTTCTCGGGAGG - 3’ and synthesized using Guide-it™ sgRNA In Vitro Transcription Kit (TaKaRa) according to manufacturer’s protocol ...
-
bioRxiv - Microbiology 2019Quote: The 5’ and 3’ RACE analyses were performed according to the protocol for the SMARTer® RACE 5’/3’ Kit (TaKaRa Bio USA ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Immunology 2020Quote: ... for 24 h and transduced with lentiviral particles by spinfection (1000 x g for 90 min at 32°C) in the presence of Polybrene (5 μg/ml) on the plates coated with Retronectin (50 μg/ml) (Takara/Clontech) and anti-CD3 (1–2 μg/ml) ...