Labshake search
Citations for Takara Bio :
451 - 500 of 5219 citations for Cyclic AMP Direct ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2020Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal (Takara Bio, USA). Plates were imaged after incubation for 60 - 72 hr at 30°C unless otherwise stated ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Concentrated virus was plated on non-TC treated 6-well plates coated with retronectin (Takara T100B), and spun for 90 minutes at 1200xg ...
-
bioRxiv - Immunology 2020Quote: ... the above plates were added with the RNase inhibitor and PrimeScript II Reverse Transcriptase (Takara, Japan) to a total volume of 10 μl ...
-
bioRxiv - Neuroscience 2023Quote: Each lysis plate well contained 4uL of lysis buffer (4U Recombinant RNase Inhibitor (Takara Bio 2313B), 0.05% Triton X-100 ...
-
bioRxiv - Immunology 2024Quote: ... The RNeasy kit and the cDNA Synthesis Kit (Takara, Cat#: 9767, RR047A) was used to extract total RNA and prepare cDNA following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Microbiology 2020Quote: ... 0.125 µl of HotStart ExTaq (TaKaRa, 5 U/µl, 0.625 U/µl final), 1 µL reverse primer (10 µM concentration ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Synthetic Biology 2022Quote: ... A total of 5 ml of Talon Metal Affinity Resin (Takara Bio USA) was added to the supernatant and mixed overnight at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 200 MOI retrovirus and 5 µg/cm2 RetroNectin reagent (Takara, Cat. No. T100A) were used in the transduction following the manufactory protocol ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The reaction system included 5 μL SYBR® Premix Ex TaqTM (Takara, China), 1 μL template ...
-
bioRxiv - Genetics 2020Quote: ... 5 μl of 10X ExTaq buffer and 0.375 μl of ExTaq polymerase (Takara) and water to a final volume of 50 μl ...
-
bioRxiv - Neuroscience 2023Quote: ... The PCR mixture contains 5 ul EmeraldAmp GT PCR Master Mix (Takara, #RR310B), 1 ul genomic DNA ...
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Genomics 2023Quote: ... 2.5 U Takara Epi Taq HS (Takara, cat. no. R110A, 5 U/µl), 2.5 mM MgCl2 ...
-
bioRxiv - Microbiology 2023Quote: ... The sample was loaded onto a 5-ml TALON metal affinity resin (Clontech) equilibrated in loading buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... The clarified supernatant was incubated with 5 ml of TALON resin (Takara Bio) for 90 min at 4°C ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: LATaq Kit (RR002B, TaKaRa) was used in nested PCR ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
Effects of Sanhuang plaster on expression of MyD88, TRAF6, MIP-1β and IL-23 in rats infected by MRSAbioRxiv - Molecular Biology 2022Quote: ... Real-time fluorescence quantitative PCR kit and reverse transcription kit(TaKaRa Co., Ltd.); MyD88 Anti-body TRAF6 Anti-body MIP-1β Anti-body and IL-23 Anti-body (GeneTexCo. ...
-
bioRxiv - Biophysics 2020Quote: ... using a cDNA synthesis kit (PrimeScript 1st strand cDNA Synthesis Kit, Takara Bio), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Adeno-X Maxi Purification Kit and Adeno-X Rapid Titer Kit from Clontech were used for purification and titration ...
-
bioRxiv - Cancer Biology 2023Quote: ... Adeno-X Maxi Purification Kit and Adeno-X Rapid Titer Kit from Clontech were used ...
-
bioRxiv - Immunology 2021Quote: ... 24-well non-tissue culture plate wells were pre-coated with RetroNectin® (Takara Bio USA, Inc.) according to manufacturer’s instructions and then day 10 cultured Tregs were added at 0.3 x 106 cells/well in 0.3mL of cell culture media ...
-
bioRxiv - Molecular Biology 2020Quote: Lysis plates were created by dispensing 0.4 μl lysis buffer (0.5U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% Triton™ X-100 (Sigma ...
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Cancer Biology 2020Quote: ... Each well of the 96-well plate contained 3µL lysis buffer (10U Recombinant RNase Inhibitor (Takara Bio), 0.2% Triton X-100 (Sigma-Aldrich) ...
-
bioRxiv - Systems Biology 2022Quote: ... In brief we sorted labeled T cells into 384 well plates (Armadillo) containing 3μl of Smart-seq3 lysis buffer (0.04μl RNAse inhibitor (40U/μl RRI, TaKaRa), 0.1% Triton X-100 ...
-
bioRxiv - Microbiology 2022Quote: ... treatment was used for cDNA library preparation using Make Your Own “Mate & Plate™” Library System (TaKaRa). All the procedures were followed according to the manual provided ...
-
bioRxiv - Microbiology 2022Quote: ... Make Your Own “Mate & Plate™” Library System and Yeast Transformation System 2 were purchased from TaKaRa. Synthetic-defined (SD ...
-
bioRxiv - Cancer Biology 2022Quote: ... Retroviruses corresponding to different CAR constructs were transduced into activated T cells in retronectin-coated plates (Takara). Cultures were allowed to expand for 10 days in their media supplemented with 300 IU ml-1 IL-2 ...
-
bioRxiv - Immunology 2019Quote: ... Retroviral supernatant was added to non-treated retronectin-coated (10 µg/ml) 6-well plates (Takara Bio) and spun for 30 min (1,200 x g ...
-
bioRxiv - Bioengineering 2020Quote: ... Transformed strains were grown at 30 °C on agar plates containing minimal SD base (Clontech, cat. 630411) and –His/–Trp/–Ura dropout supplement (Clontech ...
-
bioRxiv - Plant Biology 2021Quote: ... the cDNA library was prepared using the “mate and plate” library preparation system (Clontech, Mountain View, USA). The prepared library ...
-
bioRxiv - Cancer Biology 2019Quote: Lysis plates were created by dispensing 0.4 µl lysis buffer (0.5U Recombinant RNase Inhibitor (Takara Bio, 2313B), 0.0625% TritonTM X-100 (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... Transduction was performed on non-tissue culture 24-well plates previously coated with 0.5mL of RetroNectin (Takara) at a concentration of 25 μg/mL in PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Activated T cells were transduced with the retroviral supernatant using retronectin-coated plates (Takara Bio Inc, T100B). T cells were harvested after three days and expanded in complete medium (45% RPMI-1640 (Corning ...
-
bioRxiv - Genetics 2021Quote: The PCR reaction mixture contained 0.05 μl Ex Taq polymerase (5 U/μl, TAKARA), 1μl 10X Ex Taq Buffer (20 mM ...
-
bioRxiv - Microbiology 2019Quote: ... cells were transiently transfected with 5 µg of the pTRE3G-Luc control vector (Clontech) using Lipofectamine LTX (see above) ...
-
bioRxiv - Neuroscience 2021Quote: ... transfected at 5-7 DIV with the plasmid peGFP-N1 (Clontech, Mountain View, CA) using lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5 μL of Yeastmaker Carrier DNA (10 mg/mL, #630440, Takara Bio, Kusatsu, Japan), 1 μL of genome-editing plasmid (200–600 ng) ...
-
bioRxiv - Genomics 2020Quote: ... and 72°C for 5 s) on the PCR Thermal Cycler Dice (Takara Bio) using PrimeSTAR MAX DNA polymerase (Takara Bio) ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Biochemistry 2020Quote: ... Clarified supernatants were purified using a 5 mL Cobalt or Nickel affinity column (Takara). Purified protein was concentrated ...
-
bioRxiv - Plant Biology 2022Quote: ... milk 5%) and incubated with a 2000-fold dilution of anti-GFP (JL8; Clontech), anti-RGA (Agrisera) ...
-
bioRxiv - Neuroscience 2021Quote: A floxed stop cassette (69) was inserted 5’ of the tTA2 coding sequence (Clontech) into the plasmid pcDNA3 (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... Supernatants were harvested 5 days post-transfection and passed over Cobalt-TALON resin (Takara) followed by size exclusion chromatography on Superdex 200 Increase 10/300 GL (GE Healthcare ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Microbiology 2022Quote: A DNA matrix (Supplementary Table 5) was prepared with CloneAmp HiFi PCR Premix (Takara) using primer pair 56/60 (Supplementary Table 4 ...