Labshake search
Citations for Takara Bio :
301 - 350 of 5388 citations for Cow Four And A Half LIM Domains Protein 2 FHL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... cell-free protein expression system from Takara Bio Inc ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified using Talon resin (Clontech), eluted in 200 mM imidazole ...
-
bioRxiv - Zoology 2020Quote: ... The protein concentration was measured by TaKaRa BCA Protein Assay Kit (Takara Bio ...
-
bioRxiv - Molecular Biology 2019Quote: ... and protein was incubated with Talon (Clontech), 0.5 ml resin per litre cell culture for 1 h at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... the Capturem Protein A technology from Takara was employed according to the manufacturer’s protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... subtilis Secretory Protein Expression System (TAKARA Bio). For signal peptide library transformation into B ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Molecular Biology 2023Quote: Expression plasmids for fusion proteins of GFP and tardigrade proteins were constructed by Gibson assembly into pEGFP-N1 (Clontech) of the tardigrade cDNA (obtained by gene synthesis from Integrated DNA ...
-
bioRxiv - Molecular Biology 2020Quote: A codon-optimized synthetic gene corresponding to the full length nucleocapsid protein (Thermo GeneArt, Regensburg, Germany) was cloned into a modified pET28a vector using the In-Fusion cloning kit (Takara Bio Saint-Germain-en-Laye, France). The resulting plasmid encoded for an N-terminal His6 tag followed by thrombin and tobacco etch virus cleavage sequences upstream of the full-length nucleocapsid protein sequence ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Cell Biology 2019Quote: ... and both proteins were separated from each other and from a protein encoded by blasticidin resistance gene (cloned from pQCXIB #631516, Clontech) by self-cleavage peptide P2A ...
-
Osh6 requires Ist2 for localization to the ER-PM contacts and efficient phosphatidylserine transportbioRxiv - Cell Biology 2020Quote: For testing protein-protein interactions Matchmaker™ GAL4 Two-Hybrid System 3 was used according to the manufacturer’s instructions (Clontech). Briefly ...
-
bioRxiv - Cancer Biology 2024Quote: ... Eukaryotic expression vectors encoding green fluorescent protein (GFP)-tagged proteins were generated by inserting PCR-amplified fragments into pd1-EGFP-N1 vector (6073-1, Clontech). Prokaryotic plasmids encoding GST-fusion proteins were constructed using pGEX-4T-1 bacterial expression vector (27-4580-01 ...
-
bioRxiv - Genomics 2020Quote: ... CAS9 protein was purchased from Clontech (Cat # 632641). For injection ...
-
bioRxiv - Biochemistry 2021Quote: ... Protein was purified using amylose-agarose resin (Clontech) and eluted in 10 mM maltose ...
-
bioRxiv - Biochemistry 2020Quote: ... Protein concentration was determined by Bradford assay (TAKARA). Nickel affinity purification of 10His-SUMO1T95R conjugates was carried out with Ni-NTA agarose beads (Qiagen) ...
-
bioRxiv - Biochemistry 2022Quote: ... Proteins were bound to TALON IMAC resin (Clontech) overnight at 4 °C ...
-
bioRxiv - Microbiology 2021Quote: ... and protein purified using TALON resin (Takara Bio) using standard protocols in 50 mM phosphate buffer pH7.4 containing 300mM NaCl.
-
bioRxiv - Molecular Biology 2022Quote: ... The protein was purified by TALON affinity (Clontech), HiTrap-Q anion-exchange (Cytiva ...
-
bioRxiv - Microbiology 2022Quote: ... proteins were purified using Talon resin (Takara Bio) by resuspending the cell pellet in lysis buffer (50 mM phosphate buffer and 300 mM NaCl ...
-
bioRxiv - Neuroscience 2023Quote: ... Red Fluorescent Protein Antibody (DsRed, 1:500, Clontech). The brain sections were incubated with antibodies in blocking solution at 4°C temperature overnight ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... recombinant protein (vector pColdTM TF-DNA, Takara Clontech) to use as the antigen ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... recombinant protein (vector pColdTM TF-DNA, Takara Clontech) to use as the antigen ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg cDNA (Takara, Clonetech, USA) was prepared as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 × 106 Lenti-X 293T cells (Clontech) were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Microbiology 2020Quote: ... or Advantage 2 Polymerase mix (Takara Bio) for amplification of UTRs and Pfmyob ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Advantage 2 polymerase (TaKaRa Bio, Shiga, Japan), or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µL Smartscribe Reverse Transcriptase (Takara). RNA mixtures were combined with the RT reaction mixture ...
-
bioRxiv - Cell Biology 2021Quote: ... a plasmid expressing enhanced green fluorescent protein (EGFP) (Clontech), or in another series of experiments with pVSV-G ...
-
bioRxiv - Biophysics 2020Quote: ... The protein was initially purified using Talon resin (Clontech) with a linear gradient of 50 to 200 mM imidazole ...
-
bioRxiv - Molecular Biology 2021Quote: ... Proteins were purified using TALON Metal Affinity Resin (Clontech) and dialyzed overnight against PBS buffer ...
-
bioRxiv - Immunology 2020Quote: ... The protein concentration was determined by Bradford assay (Takara), and the cell lysate was mixed with 4x Laemmli loading buffer containing β mercapto-ethanol ...
-
bioRxiv - Plant Biology 2022Quote: ... Bound proteins were detected using Hyper HRP Substrate (Takara). PtIns(3,5)P2 Grip protein (P-3516-3-EC ...