Labshake search
Citations for Takara Bio :
101 - 150 of 5204 citations for Cortisol ELISA Kit 5 Whole Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2022Quote: Whole bladder protein lysate was obtained by homogenizing bladder tissue using Biomasher II (TaKaRa) in ice-cold RIPA buffer with the protease inhibitor (ThermoFisher Scientific) ...
-
bioRxiv - Plant Biology 2022Quote: ... The total RNA was extracted from the whole plant using NucleoSpin RNA (Takara, Japan). Sequence data of LmZTL_1 (LC708291) ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was extracted from whole brains of mice using Trizol agent (Takara, Japan) and treated with DNase following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
Plant pathogens convergently evolved to counteract redundant nodes of an NLR immune receptor networkbioRxiv - Plant Biology 2021Quote: ... Single colonies grown on selection plates were inoculated in 5 ml of SD-Leu-Trp overnight at 28 °C (ST0047, Takara Bio, USA). Saturated culture was then used to make serial dilutions of OD600 1 ...
-
bioRxiv - Microbiology 2021Quote: ... at 30°C for 3-5 days and assayed for growth on the SD/-Trp/-Leu/-His/-Ade/X-α-gal plates (TaKaRa Bio). Each experiment was repeated at least three times.
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Zoology 2021Quote: ... The 3′-RACE assay was performed using the SMARTer RACE 5′/3′ Kit (CA94043, TaKara) following the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Biochemistry 2019Quote: ... Mutations of LAT1 were introduced by whole plasmid PCR using PrimeSTAR MAX DNA polymerase (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: cDNA was generated from single cells in the 96-well plate using the SmartSeq v4 kits (Takara Bio) using 1/4th volume reactions dispensed using a Mantis dispenser (Formulatrix) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 5’ and 3’ RACE ready cDNA was generated from a pooled female pupal RNA sample and also from a pooled adult female ovary sample (RNA extracted using RNeasy MinElute kit, RACE conducted using SMARTer 5⍰/3⍰ RACE kit - Takara Bio, Kyoto, Japan). Visible bands were cloned using the NEB PCR cloning kit (New England Biolabs ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the beta-globin (HBB) 5’-UTR using the In-Fusion® HD Cloning Kit (Takara). The subsequent mutations in the TCRA and TCRB 3’-UTRs were generated using these initial constructs ...
-
bioRxiv - Immunology 2019Quote: ... 5’ RACE first-strand cDNA synthesis was conducted using the SMARTer RACE cDNA Amplification Kit (Takara Bio ...
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Cell Biology 2023Quote: ... and 5 µg RNA was reverse transcribed into cDNA using a cDNA synthesis kit (Takara Bio) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... The TCR sequences were then isolated using 5’RACE (SMARTer RACE cDNA Amplification Kit, Takara Bio), followed by PCR amplification with primers designed to be complementary to TRAC (GTTGCTCCAGGCAATGGCCCCATTGCTC ...
-
bioRxiv - Microbiology 2021Quote: ... An anti-histidine antibody was used for ELISAs as positive control (Takara, catalog # 631212).
-
bioRxiv - Cancer Biology 2023Quote: Retroviral supernatant was collected two and three days after transfection of GP2-293T cells and concentrated onto wells of a 6 well plates coated with Retronectin (Takara Bio, 5 ug/ml) by spinning at 2500g for 90 minutes at 32° C ...
-
miR-125-chinmo pathway regulates dietary restriction dependent enhancement of lifespan in DrosophilabioRxiv - Molecular Biology 2020Quote: Total RNA was extracted from whole fly or tissue samples using RNAiso Plus (Takara Bio, Inc). Animals/tissues were homogenized in 0.2 ml of RNAiso Plus with a micropestle (Tarsons ...
-
bioRxiv - Molecular Biology 2022Quote: ... The whole cloning reaction was used to transform Stellar™ chemically competent cells (Clontech® Laboratories) using the heat shock method ...
-
bioRxiv - Microbiology 2024Quote: ... Plasmids were constructed by PCR amplification of the whole plasmids with the CloneAmp Hifi polymerase (Takara) and assembly of the insert part with the NEBuilder HiFi DNA Assembly kit ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Molecular Biology 2021Quote: 20 cm plates of HEK293T cells were transfected with 10 µg of each plasmid using CalPhos transfection kit (Takara) according to manufacturer’s instructions and harvested 3 days later ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Molecular Biology 2024Quote: ... or 5 ng of total RNA (with a SMARTer Stranded Total RNA-Seq Kit v3; Takara Bio) was used.
-
bioRxiv - Microbiology 2019Quote: ... Whole genomic amplification of the influenza virus was conducted using Ex Taq™ Hot Start Version (TaKaRa). Forward primers were Uni-1.5 and Uni-0.5 mixed in a ratio of 3:2 ...
-
bioRxiv - Genomics 2019Quote: ... we prepared whole genome sequencing libraries using 0.6-67.3 ng input using ThruPLEX Plasma-seq (Takara Bio). We performed sequencing on NovaSeq 6000 (Illumina ...
-
bioRxiv - Neuroscience 2020Quote: ... 341F (5’-CCTACGGGNGGCWGCAG-3’) and 805R (5’-GACTACHVGGGTATCTAATCC-3’) or (2) 341F (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’) and 806R (5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGGACTACHVGGGTWTCTAAT-3’) (TaKaRa Bio, Shiga, Japan). The second PCR was performed to add the index sequences for Illumina sequencing with barcode sequences ...
-
bioRxiv - Microbiology 2022Quote: ... The plasmids were extracted from all the colonies which grew on QDO/X/A agar plate using Easy Yeast Plasmid Isolation Kit (TaKaRa). PCR was carried out using the extracted plasmids as template ...
-
bioRxiv - Cell Biology 2021Quote: Transfection of Halo-tagged AnkB440 plasmids were conducted in HEK293T cells grown in 10 cm culture plates using the calcium phosphate transfection kit (Takara) and 8 µg of plasmid ...
-
bioRxiv - Immunology 2023Quote: ... into 96-well plates containing 12.5μl CDS sorting buffer as described in the SMART-Seq® HT Kit protocol (Takara Bio). Full-length cDNA amplification of single cells was performed per the kit protocol (Takara Bio) ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Biophysics 2022Quote: ... 3’-RACE-Ready cDNA template was synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 3’ end sequences of R ...
-
bioRxiv - Immunology 2022Quote: ... IGK and IGL 5’RACE AIRR-seq libraries were generated using the SMARTer Mouse BCR Profiling Kit (Takara Bio ...
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and used for library preparation (5-10 ng) using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech). Libraries were sequenced on Novaseq platform (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2023Quote: ... non-adherent plate (Takara Bio). Cells were grown for 14 days ...
-
bioRxiv - Neuroscience 2019Quote: ... test genes (vascular connexins) in human vessels were normalized relative to human whole heart (RNA purchased from Clontech) and in mouse ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR products covering the whole sesRNA region was generated with CloneAmp HiFi PCR Premix (Takara, Cat. No. 639298), and purified with NucleoSpin Gel and PCR Clean-up kit (Takara ...
-
bioRxiv - Genomics 2023Quote: ... 100 ng to 1 µg of total RNA was used for Hi-Mammalian whole transcriptome preparation (Takara Bio) and sequencing was performed on Nextseq2000 instrument with 1 x 72 bp single-end setup ...
-
bioRxiv - Neuroscience 2023Quote: Genomic DNA was extracted from 10 whole bodies of wandering flies using MightyPrep reagent for DNA (Takara #9182). Whole body RNA was extracted from 10 whole bodies of wandering flies using TRIzol (Ambion #15596018) ...