Labshake search
Citations for Takara Bio :
1 - 50 of 1966 citations for Carbamic acid 2 4 hexadienyl 1 1 dimethylethyl ester E E 9ci since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2020Quote: ... anti-E-Cad 1:200 (M108, clone ECCD-2, TaKaRa), anti-Nanog 1:200 (eBIO-MLC51) ...
-
bioRxiv - Developmental Biology 2024Quote: ... rat monoclonal anti-E-cadherin antibody (ECCD-2) (1:200) (Takara, Cat# M108), mouse monoclonal anti-Yap1 antibody (MO1 ...
-
bioRxiv - Developmental Biology 2023Quote: ... anti-E-Cadherin (CDH1, Takara M108, 1:200), anti-GATA6 (R&D ...
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... E-cadherin antibody (HECD-1, 1:1000 IF, 1:1000 WB) was from Takara Bio ...
-
bioRxiv - Developmental Biology 2022Quote: ... anti-E-cadherin rat monoclonal antibody (Takara, M108, 1:500), anti-GFRα1 goat polyclonal antibody (R&D Systems ...
-
bioRxiv - Physiology 2024Quote: ... and rat anti-E-cadherin (1:200, Takara Bio, M108). Next ...
-
bioRxiv - Cell Biology 2024Quote: ... and E-cadherin (1:500; ECCD2 M108; Takara Bio Europe). Alexa FluorTM 647 ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: Mouse monoclonal E-cadherin antibody (HECD-1) was purchased from Takara Bio Inc ...
-
bioRxiv - Cell Biology 2024Quote: ... Rat anti-E-cadherin mAb (ECCD-2, IB) from TaKaRa; Goat anti-LXR alpha + LXR beta pAb (ab24362 ...
-
bioRxiv - Developmental Biology 2022Quote: ... rat anti-E-Cadherin (TAKARA; M110), rat anti-Endomucin (Santa Cruz ...
-
bioRxiv - Cancer Biology 2023Quote: ... Antibodies against E-cadherin (clone ECCD2 Takara, M108), c-Jun (CST #9165) ...
-
bioRxiv - Cell Biology 2024Quote: ... rat anti-E-cadherin mAb (ECCD2; Takara Bio); rabbit anti-RhoA mAb (2117 ...
-
bioRxiv - Molecular Biology 2020Quote: ... we first produced lentivirus with Pup (E) plasmid Bio-Pup (E)-IRES-BFP within the Tet-On 3G inducible expression system (Clontech 631168), and infected OVCAR-5 cells for 48 hours ...
-
bioRxiv - Cell Biology 2021Quote: ... we first produced lentivirus with Pup(E) plasmid Biotin-Pup(E)-IRES-BFP within the Tet-On 3G inducible expression system (Clontech 631168), and infected Jurkat cells for 48 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Rat anti-E-cadherin mAb (ECCD2; M108, Takara Bio), mouse anti-α-tubulin mAb (14-4502-82 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Primary antibodies used were CDH1 (E-CADHERIN) (M106, Takara Biosciences) for glandular and luminal epithelial staining ...
-
bioRxiv - Cancer Biology 2022Quote: ... Rabbit polyclonal antibodies used were: HECD1 (anti-E-cadherin; Takara), anti-Melan-A (ab15468 ...
-
bioRxiv - Microbiology 2020Quote: ... D and E using high fidelity PrimeSTAR Max DNA Polymerase (Takara). T7 promoter was introduced upstream of 5’ UTR of SARS-CoV-2 genome in fragment A ...
-
bioRxiv - Immunology 2024Quote: ... the plasmids were transformed into E coli Stellar Competent Cells (Takara) and selected with ampicillin (50μg/ml ...
-
bioRxiv - Biophysics 2022Quote: ... E-cadherin (24E10-Cell Signaling Technology; DECMA1-Sigma Aldrich, ECCD2, Takara Bio) (1:100)and paxillin (Abcam ...
-
bioRxiv - Cell Biology 2020Quote: ... S5C-E was generated by fusing human Rac1 cDNA into EGFP-C1 (Clontech) and kindly provided by Dr ...
-
bioRxiv - Microbiology 2023Quote: ... RNase E was then purified using TALON® Metal Affinity Resin (Takara Bio). Protein purity was confirmed by SDS-polyacrylamide gel electrophoresis (PAGE ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Cell Biology 2023Quote: ... TagRFP-CENP-E 2111-C were cloned into the pLVX-IRES-Puro vector (Clontech) by PCR-based Gibson assembly method.
-
bioRxiv - Cell Biology 2023Quote: HaCaT cells were treated with the E-cadherin-blocking antibody (SHE78-7, Takara, Shiga, Japan), PY-60 (Axon Medchem ...
-
bioRxiv - Systems Biology 2024Quote: ... Ligated plasmid products were transformed into stellar competent cells (E. coli HST08 strain, Takara Bio). See Dataset EV1 for full descriptions of constructs.
-
bioRxiv - Cell Biology 2024Quote: Paraffin sections were used for H/E staining and ALP staining with a commercial staining kit (TaKaRa, TRACP & ALP double-stain kit ...
-
bioRxiv - Immunology 2023Quote: ... RVFV L segment RNA and SARS E RNA were detected with PrimeDirect™ Probe RT-qPCR Mix (Takara, RR650A) according to manufacturer’s instructions using RVFV L primers fwd 5’ TGAAAATTCCTGAGACACATGG 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... the pLVX-ORF3-E plasmid was transfected into HEK-293T cells using the Lenti-X Packaging Single Shots kit (Takara). Lentiviral supernatants were harvested at 72 h post-transfection and filtered through a 0.22 μM membrane (Millipore ...
-
bioRxiv - Biophysics 2024Quote: ... DNA anchor (3’-alkyne-modified) was purchased from Fasmac (Kanagawa, Japan). RNase H from E. coli (Product No. 2150A) was purchased from Takara Bio Inc ...
-
bioRxiv - Cell Biology 2024Quote: For immunostaining the following antibodies were used: mouse anti-E-cadherin mAb clones SHE78-7 and HECD1 (Takara, M126 and M106), mouse anti-vinculin (Sigma ...
-
bioRxiv - Microbiology 2024Quote: ... reactions were performed to insert these linear fragments into the pMV306 previously digested with EcoRV and transformed into Escherichia coli (E. coli) Stellar TM competent cells (Takara Bio), purified (NucleoSpin Plasmid ...
-
bioRxiv - Genomics 2021Quote: ... coli HST08 (used to test coregulation of genes in newly-formed operons and for vector construction; E. coli HST08 Premium Competent Cells, Takara Bio, Japan, 9128).
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 N and E genes were transcribed from the pBluescript-N and pUC57-E plasmids by adding a T7 promoter via PCR using Premix Taq (Cat. No. R004A, TAKARA, Shuzo, Shiga, Japan). The crRNA templates were amplified from a pUC57-T7-crRNA (Supplementary Table S10 ...
-
bioRxiv - Genetics 2024Quote: ... The single-stranded portion of a 5-prime adapter was inserted into the breeding terminus of the RNA-cDNA hybrids and incorporated into a complete library molecule using DNA polymerase I (E. coli; Takara Bio, Shiga, Japan). PCR enrichment was performed using KOD One PCR Master Mix (TOYOBO ...
-
bioRxiv - Neuroscience 2022Quote: ... protein lysate was immunoprecipitated for 2 h at 4°C with the following antibodies: mouse anti-GFP (1:1000; Takara Bio), mouse anti-FLAG (1:1000 ...
-
bioRxiv - Systems Biology 2023Quote: ... was used as the wild-type (WT) strain for genetic manipulations. Chemically competent Escherichia coli (E. coli) DH5α and HST08 (Stellar Competent Cells, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) were used as the host strains for molecular cloning.
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Plant Biology 2020Quote: ... incubated overnight at 4°C with anti-GFP (Takara 632380, 1:10000), washed in TBS-T ...
-
bioRxiv - Cancer Biology 2024Quote: ... we employed the MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) or WST-1 (Water-Soluble Tetrazolium 1) assay from Takara, Japan ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... The membranes were blocked in 5% non-fat milk in TBST for 1 h and immunoblotted with antibodies against GFP (anti-GFP.1, 4°C overnight, Takara Bio Clontech, 632381 or anti-GFP.2 ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-1 was pretreated with 2 μg/ml DNase (Takara, Japan), and then diluted to MOI=20 ...
-
bioRxiv - Neuroscience 2023Quote: ... fixed for 1 h in 4% paraformaldehyde/PBS (TAKARA BIO INC. Cat#T900), and subjected to antibody labeling ...
-
bioRxiv - Neuroscience 2024Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:4 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 2 and 10 column volumes of Membrane Buffer 2 with 20 mM imidazole before elution with Membrane Buffer 2 with 300 mM imidazole ...
-
bioRxiv - Neuroscience 2024Quote: ... The non-solubilized fraction was separated by centrifugation at 47850 x g for 1 h at 4 °C and 4 mL of cobalt-charged TALON resin (Clontech, Takara) was added to the solubilized fraction for batch binding (3 h at 4 °C) ...