Labshake search
Citations for Takara Bio :
501 - 550 of 993 citations for CEACAM 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Bioengineering 2019Quote: The promoter of the HSPA6 gene (Uniprot P17066) was amplified from human genomic DNA (Clontech #636401) from −1231 bp to +119 bp relative to the transcriptional start site ...
-
bioRxiv - Biochemistry 2019Quote: Human LRAT cDNA was synthesized and cloned into a pcDNA3.1(+) vector (Clontech, Palo Alto, California, USA) by a third party (GeneArt ...
-
bioRxiv - Cancer Biology 2019Quote: ... The human patient PDX cell lines were maintained in RPMI-1640 medium containing 10% FBS (Clontech). KRAS mutation status ...
-
bioRxiv - Biochemistry 2020Quote: ... Human IFITM3 cDNA was purchased from Open Biosystems and PCR cloned into pCMV-HA vector (Clontech). All mutants of IFITM3 were generated by using QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies ...
-
bioRxiv - Cell Biology 2021Quote: ... for the samples from the mouse heart or Human Mitochondrial DNA Monitoring Primer Set (TaKaRa Bio) for the cells following manufacturer protocol.
-
bioRxiv - Genomics 2022Quote: ... 100 ng of polyA selected RNA from the human lung carcinoma cell line A549 (Takara #636141) was used as input ...
-
bioRxiv - Physiology 2022Quote: ... the cDNAs of full length human GCNA or IDR hGCNA were cloned into pEGFP-C1 (Clontech) between BglII and SalI sites ...
-
bioRxiv - Genetics 2019Quote: Regions orthologous to human placental igDMR were PCR-amplified with TaKaRa EX Taq HS (TaKaRa Bio) with primers specific for chimpanzee and rhesus macaque CGIs (Supplementary Table 4) ...
-
bioRxiv - Cell Biology 2020Quote: ... Constructs for C-terminal GFP-tagged human RHBDL4 were generated by subcloning into pEGFP-N1 (Clontech). For generating point mutants ...
-
bioRxiv - Cell Biology 2020Quote: Human sparc cDNA clone was described by us before 29 and subcloned into pShuttle vector (Clontech). Adenovirus expressing human SPARC was constructed using Adeno-X expression system (Clontech ...
-
bioRxiv - Cell Biology 2021Quote: ... OCIAD1 was initially cloned from human cDNA into a pAcGFP-N1 vector (Clontech, Mountain View, CA). The GFP1-10 vectors were cloned by Gibson assembly into a FUGW lentiviral backbone (Addgene ...
-
bioRxiv - Cell Biology 2023Quote: ... the cDNA encoding human Wt-syn was introduced into a vector from Clontech (Mountain View, CA) containing the mRFP sequence ...
-
bioRxiv - Neuroscience 2023Quote: ... Human cDNA for α7-nAChRs and NACHO inserts were cloned using In-fusion cloning kit (Takara). After cloning in the lentiviral transfer plasmids ...
-
bioRxiv - Cancer Biology 2023Quote: PDGF-IRES-Cre was generated by cloning human PDGF-B and Cre into pQXIX vector (Clontech) as previously described5 ...
-
bioRxiv - Immunology 2023Quote: ... The human J chain was replaced with the DsRed2 gene of pDsRedN1 (Takara Bio, Shiga, Japan). The pIgR gene was inserted into the pEF-Myc-His vector (ThermoFisher Scientific ...
-
bioRxiv - Biophysics 2023Quote: Human cell lines used in this study include U2OS and Lenti-X 293T (Takara Bio USA). Lenti-X 293T cells were only used for virus production ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... A/C Heterodimerizer AP21967 (Takara Bio, 500 nM for 5 hours), Okadaic Acid (Santa Cruz Biotechnology ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL21 and purified on 5 mL Talon column (Clontech®) loaded with Cobalt ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysate was incubated with 5 mL TALON beads (Takara Bio), washed with 150 mL lysis buffer and eluted in 22 mL of elution buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and deoxyribonuclease I (DNase I, 5 units/mL, Takara, Shiga, Japan) for 15 min ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Immunology 2019Quote: ... The diafiltrated medium was loaded onto 5 ml Talon resin (Clontech), washed with 10 CV of 250 mM NaCl ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with D/D-Solubilizer (5 μM, Clonetech/Takara) and Cycloheximide (35.54 μM ...
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were loaded on 5 mL of TALON beads (Takara Bio) pre-equilibrated with the lysis buffer ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Immunology 2020Quote: ... Activated NK cells were transduced with retroviral supernatants on day +4 in human fibronectin-coated plates (Clontech Laboratories ...
-
bioRxiv - Molecular Biology 2019Quote: ... the cDNA was amplified by a polymerase chain reaction from a human brain cDNA library (Clontech, CA) using an appropriate primer pair ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The plasmid GFP-GT198 contained full-length human GT198 in a pEGFP-C3 vector (Clontech, 6082-1). HeLa cells transfected with GFP-GT198 (green ...
-
bioRxiv - Cancer Biology 2021Quote: shRNA directed against human MAGI1 and AMOTL2 were constructed and cloned in the pSIREN-RetroQ vector (TaKaRa) according to the manufacturer’s conditions between BamHI and EcoRI cloning sites as previously described for other genes 75 ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated from a human lung poly-A+ RNA (cat. 636105, Takara Bio, Kusatsu, Shiga, Japan) using a cDNA library construction kit (Takara Bio ...
-
bioRxiv - Immunology 2020Quote: The pIRES-DsRed2 and pDsRed2-C1 vectors used to express various human aquaporin constructs were from Clontech. The human pCMV6-AC-AQP9-GFP expression vector was from Origene ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Immunology 2022Quote: ... cloned into pTT3-based IgG expression vectors with human constant regions (84) using In-Fusion cloning (Clontech), expressed in 293 cells ...
-
bioRxiv - Neuroscience 2024Quote: ... Human KCNQ2 cDNA (GenBank accession number NM_172108) in pIRES2-EGFP (BD Biosciences-Clontech, Mountain View, CA, USA) was used as template for in vitro mutagenesis ...
-
bioRxiv - Cancer Biology 2019Quote: ... A full-length Myc tagged cDNA expressing human NEK9 (NM_001329237.1) was subcloned into the pVLX-Tight-Puro vector (Clontech). The RCC1 domain was deleted using the Quickchange® II XL Site-Directed Mutagenesis Kit according to manufacturer’s instructions (Stratagene ...