Labshake search
Citations for Takara Bio :
501 - 550 of 1752 citations for Breast Cancer Type 1 Susceptibility Protein BRCA1 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2019Quote: ... 30 µg of microsomal proteins were then treated with 30 units of calf intestinal alkaline phosphatase (TaKaRa) at 37°C for 2 h ...
-
bioRxiv - Biochemistry 2019Quote: The supernatant from purification of His6-tagged proteins was loaded onto a self-packed cobalt column (Clontech). Unbound proteins were washed off with Loading Buffer (50 mM Tris-HCl [pH 7.4] ...
-
bioRxiv - Biochemistry 2020Quote: ... Proteins were expressed in Escherichia coli strain BL21(DE3) cells containing chaperone plasmid pG-KJE8 (TAKARA, 3340). When the optical density at 600 nm reached 0.6 ...
-
bioRxiv - Microbiology 2020Quote: ... the His-tagged spike protein produced in the culture supernatants was purified with a Talon resin (Clontech).
-
bioRxiv - Microbiology 2021Quote: U937 cell lines stably expressing red fluorescent protein membrane were generated using pDsRed-Monomer-Mem (Takara Bio) cloned into pLB vector from Addgene (Addgene plasmid 11619 ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Cell Biology 2020Quote: ... The expressed protein was purified using hexa-histidine-tag and GST-tag by Talon-resin (Clontech/Takara) or Glutathione-sepharose (GE healthcare ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... and TATA-binding protein (TBP) (MA050367) were obtained from the Perfect Real-Time Supporting System (Takara Bio). The mRNA expression level was standardised to that of TBP.
-
bioRxiv - Developmental Biology 2020Quote: ... Both chicken DLX1 and DLX1 Q50E proteins were purified using Capturem His-Tagged Purification Maxiprep Kit (Clontech), and verified by Western blot with primary antibodies against 6x His tag (Invitrogen ...
-
bioRxiv - Biochemistry 2021Quote: ... After 12 h medium was collected and recombinant proteins were purified on TALON metal affinity resin (Takara). 200 μl of the resin was loaded onto 1 ml column (Bio-Rad ...
-
bioRxiv - Cell Biology 2023Quote: ... The concentration of the purified protein was assessed by densitometry using bovine serum albumin (TaKaRa, cat. # T9310A) as a standard following SDS-PAGE and staining with the Q-stain ...
-
bioRxiv - Molecular Biology 2023Quote: ... cDNAs encoding for sequences of proteins of interest were amplified and inserted into pEGFP-N1 vector (Clontech). Each DNA construct was checked by conventional Sanger sequencing of purified plasmid.
-
bioRxiv - Bioengineering 2024Quote: ... All proteins were purified with a Talon metal affinity resin (Takara Bio USA, Mountain View, CA, USA) and dialyzed against pyrogen-free PBS ...
-
bioRxiv - Genomics 2020Quote: ... and Living Colors DsRed Polyclonal Antibody (rabbit anti-E2-Crimson, Clontech [now Takara Bio USA] ...
-
bioRxiv - Genetics 2019Quote: ... GAL4 DNA-BD Mouse Monoclonal Antibody (Takara Bio USA, Inc. #630403), and GAPDH Mouse Monoclonal Antibody (CB1001-500UG 6C5 ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: GFP (JL-8, Clontech, #632381), Tubulin (Covance ...
-
bioRxiv - Cell Biology 2021Quote: ... JL-8 anti-GFP monoclonal antibody (TaKaRa, catalog # 632381, lot # A8034133) at 1:2,000 dilution ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-CHS (sc-12620 ...
-
bioRxiv - Cell Biology 2021Quote: ... Monoclonal mouse anti-GFP antibodies (JL-8) were from Clontech (632381). Monoclonal mouse anti-Flag (M2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... and/or mCherry (Living Colors DsRed Polyclonal Antibody #632496, Takara, Japan) after in situ hybridization were carried out as described in (Chen Q et al. ...
-
bioRxiv - Cell Biology 2019Quote: ... followed by western blot using an anti-GFP antibody (632381, Clontech).
-
bioRxiv - Cell Biology 2020Quote: ... Living colors mouse anti-GFP monoclonal antibody was purchased from Clontech, and goat anti-mouse antibody HRP-conjugated antibody was purchased from Jackson ImmunoResearch.
-
bioRxiv - Plant Biology 2021Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-HY5 (Oravecz et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... EGFP was detected using the JL-8 mouse monoclonal antibody (Clontech). For IHC ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were then incubated with anti-GFP antibody (JL-8; Clontech) at a dilution of 1:5,000 ...
-
bioRxiv - Plant Biology 2023Quote: ... Anti-GFP (monoclonal antibody raised in mouse, Takara, USA, catalog # 632381) and anti-SEC12 (Bar-Peled and Raikhel ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... The following primary antibodies were used: mCherry (rabbit-anti-DsRed; Takara Bio ...
-
bioRxiv - Plant Biology 2024Quote: ... equilibrated with 2 μg of anti-GFP antibody (Takara Bio, 632381). Beads were washed for 2 x 10 mins in low salt wash buffer ...
-
bioRxiv - Plant Biology 2024Quote: ... We then ran a western blot using the GFP antibody (Takara living colors EGFP monoclonal antibody JL-8 ...
-
bioRxiv - Microbiology 2022Quote: ... 1% PS and doxycycline (1 μg/ml; Takara, Cat# 1311N). At 7 days posttransfection ...
-
bioRxiv - Microbiology 2022Quote: ... 1% PS and doxycycline (1 μg/ml; Takara, Cat# 1311N). At six days posttransfection ...
-
bioRxiv - Microbiology 2021Quote: ... 1% PS and doxycycline (1 μg/ml; Takara, cat# 1311N). At six days posttransfection ...
-
bioRxiv - Immunology 2021Quote: ... Protein eluted from the Strep-Tactin column was then applied to pre-equilibrated TALON Metal Affinity Resin (Takara) and allowed to enter the column by gravity flow ...
-
bioRxiv - Plant Biology 2021Quote: ... All Rec and Rad proteins were translationally fused with the Activation Domain (AD) of pGADT7 AD (Takara Bio). βC1 was fused with Binding Domain (BD ...
-
bioRxiv - Biochemistry 2020Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Microbiology 2021Quote: ... 10 μg of Spike expressor and 2 μg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 293T cells ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: ... RNA isolation and reverse transcription were performed as described in the STAR METHODS section “Ddi2 expression analysis in mouse embryos using qRT-PCR.” Constructs encoding the DDI2WT and DDI2PD proteins were cloned into p905 (gift from Pavlína Řezáčová, IOCB CAS, Prague) and pTreTight (Clontech) expression vectors.
-
bioRxiv - Immunology 2021Quote: ... secreted protein was purified from the culture supernatant 4 days post transfection using TALON metal affinity resin (Clontech) and Amicon Ultra 10K filter device (Millipore) ...
-
bioRxiv - Biochemistry 2021Quote: ... Recombinant protein was then purified by immobilized metal ion affinity chromatography using a cobalt-based matrix (Talon, Clontech) and eluted with 100 mM imidazole ...
-
bioRxiv - Plant Biology 2022Quote: ... Purification of His-tagged proteins was carried out using His-tag affinity resin (His-resin) (Clontech, CA, USA).
-
bioRxiv - Microbiology 2021Quote: CFP/YFP plasmids were constructed by cloning the fluorescent protein coding sequence into pSTV28 (Takara Bio Europe SAS) with EcoRI/SalI restriction sites ...
-
bioRxiv - Genetics 2022Quote: ... Total protein was harvested after 3 days of culture and analyzed by Western blot (mouse anti-DsRed, Clontech; rabbit anti-POU6F2 ...
-
bioRxiv - Microbiology 2022Quote: ... then the His-tagged ORF8 protein produced in the culture supernatants was purified with a Talon resin (Clontech). The absence of endotoxin contamination was confirmed using the ToxinSensor chromogenic LAL Endotoxin Assay Kit (GeneScript).
-
bioRxiv - Microbiology 2022Quote: ... 10 µg of Spike expressor and 2.5 µg of a green fluorescent protein (GFP) expressor (pIRES2-eGFP; Clontech) was transfected into 2 × 106 HEK 293T cells ...
-
bioRxiv - Plant Biology 2022Quote: ... bait and linker proteins were cloned into the appropriate position of the pBridge vector (Clontech, Mountain View, California), which encodes a GAL4 DNA binding domain and a linker protein ...
-
bioRxiv - Cell Biology 2023Quote: ... Cre recombinase proteins were delivered into TP53-missense mutation knock-in cells using Cre Recombinase Gesicles (Takara Bio).
-
bioRxiv - Microbiology 2023Quote: ... The His-tagged CRONE protein was purified by cobalt affinity chromatography using TALON® metal affinity resin (Takara) under native conditions in phosphate buffered saline (PBS) ...
-
bioRxiv - Molecular Biology 2023Quote: ... purified MBP-mEGFP/mCherry-Seb1 and MBP-mEGFP/mCherry-Rhn1 proteins were incubated with HRV 3C protease (Takara; 1 U/1 g of target recombinant proteins ...