Labshake search
Citations for Takara Bio :
351 - 400 of 743 citations for Apolipoprotein B mRNA Editing Enzyme Catalytic Subunit 3G APOBEC3G Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Amplified genes were cloned into an altered pFastBacHT B vector using the In-Fusion HD EcoDry Cloning Kit (Clontech). After transformation of DH10EMBacY E ...
-
bioRxiv - Plant Biology 2022Quote: We amplified the coding sequences of MpSETA and MpICE2 from cDNA derived from mRNA of Tak-1 thalli by PCR using PrimeSTAR Max DNA polymerase or PrimeSTAR GXL polymerase (Takara Bio). Also ...
-
bioRxiv - Neuroscience 2021Quote: ... reverse transcription and cDNA amplification were performed on the Fluidigm C1 machine according to the manufacturer’s mRNA-seq protocol using the SMARTer Ultra Low RNA Kit for the Fluidigm C1 System (Takara Bio #634833). cDNA amplicons (∼3 µL ...
-
bioRxiv - Neuroscience 2021Quote: mRNA was purified and the cDNA was synthesized with the mRNA fragments as templates using SMART-Seq V4 RNA kit (Clontech # 634889). The sequencing libraries were generated using Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1024) ...
-
bioRxiv - Immunology 2022Quote: Illumina Compatible low input mRNA libraries were prepared using the Smart-Seq V4 Ultra Low Input RNA kit (Takara Bio, USA) and KAPA HyperPlus Library Preparation kit (Roche) ...
-
bioRxiv - Cancer Biology 2022Quote: ... The expression of mRNA was examined by real-time quantitative-PCR (qRT-PCR) using SYBR Green PCR Master Mix (Takara, Japan) and a LightCycler480 Detection System (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... The single isoform of DCR1 was amplified by RT-PCR from mRNA isolated from S2 cells and reverse transcribed using the Oligo(dT)-primed RNA to cDNA EcoDry premix (Takara Bio). The CDS for AGO1 and GW182 were PCR amplified from pAFW-Ago1 (Addgene #50553 ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed on 1 µg total mRNA per sample using PrimeScript™ RT Reagent Kit with gDNA Eraser (Takara) according to the manufacturer’s instruction ...
-
bioRxiv - Microbiology 2020Quote: ... The two fragments plus the loxP-flanked erythromycin resistance gene were connected with the linear plasmid pUC19 using In-Fusion HD Enzyme (Takara, Daliang, China), generating the plasmid pUC-GSS01PilA ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cDNA used for qRT-PCR were synthesized using PrimeScript reverse transcriptase with oligo dT primer and Prime Script RT Enzyme MIX I (Takara, Osaka, Japan). qRT-PCRs was performed using the ChamQ SYBR Color qPCR Master Mix (Q411 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The amplified fragment was cloned into the EcoR I and BamH I restriction enzyme sites of pMD18-T vector (TaKaRa, Kusatsu, Japan) and verified by sequencing ...
-
bioRxiv - Microbiology 2020Quote: ... This was replaced with a golden gate-compatible (BsaI restriction enzyme site-flanked) MCS from pICH86988 using In- Fusion cloning according to kit instructions (Takara Bio, USA) to generate a golden gate cloning-compatible version of the pK18mobsacB vector ...
-
bioRxiv - Genomics 2022Quote: ... These guides were individually cloned into pAAV-U6-sasgRNA-CMV-mCherry-WPREpA (92) at the BstXI and XhoI restriction enzyme sites using the In-Fusion (Takara Bio, 638910) cloning methods as described in (92) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The C-terminus of Rtl5 was fused with mCherry by means of a cloning enzyme (In-Fusion® HD Cloning Kit, Takara Bio) and it was inserted into a pGEM T Easy vector (Promega) ...
-
bioRxiv - Microbiology 2020Quote: ... The erythromycin resistance gene was amplified from plasmid pMG36e using primer pair EmrF/EmrR and then connected with linearized pMD19-GmloxP using In-Fusion HD Enzyme (Takara, Daliang, China), generating the plasmid pMD19-EmrloxP ...
-
bioRxiv - Bioengineering 2020Quote: ... cDNA was synthesized using a mix of random hexamers – oligo d(T) primers and PrimerScript reverse transcriptase enzyme (Takara bio inc. Kit), again following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... the plasmids were cleaved using restriction enzymes and purified using electrophoresis and NucleoSpin Gel & PCR Clean-up kit (Takara bio, Shiga, Japan). The copy number of each standard DNA was calculated based on the concentration quantified with the Qubit 3 Fluorometer (Thermo Fisher Scientific ...
-
bioRxiv - Bioengineering 2022Quote: The transfer vector pABpaR2pX was constructed by inserting a DsRed2 reporter gene driven by pag promoter(46) (p-pag) into the EcoRV restriction enzyme site of pBacPAK8 (Clontech Laboratories, Inc.). cDNAs encoding HA7 and NA9 were synthesized by GenScript ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR assays were performed in final volumes of 25 μl containing 12.5 μl of 2 × PCR Taq Mastermix (MgCl, dNTP, Taq enzyme) (Takara Bio Inc., Japan); 0.5μl of each primer (10 mmol/L) ...
-
Retrovirus-derived RTL9 plays an important role in innate antifungal immunity in the eutherian brainbioRxiv - Evolutionary Biology 2023Quote: ... The C-terminus of Rtl9 was fused to a 4x GGS linker (ggaggatcaggaggatcaggaggatcaggaggatca)-attached mCherry by means of a cloning enzyme (In-Fusion® HD Cloning Kit, Takara Bio). The purified targeting vector was assessed for its quality by Sanger sequencing and injected into mouse pronuclei at the final concentration of 10 ng/μl ...
-
bioRxiv - Cell Biology 2022Quote: ... and the DNA fragments were ligated to the pcDNA5 FRT/TO HA FLAG vector (digested with the same enzymes) using a DNA Ligation Kit (#6023; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Hu sec11a and pcDNA5 FRT/TO HA FLAG Hu sec11c ...
-
bioRxiv - Cell Biology 2022Quote: ... and the DNA fragments were ligated into the pcDNA5 FRT/TO HA FLAG vector (digested with same enzymes) using a DNA Ligation Kit (#6023; TaKaRa, Kusatsu, Japan), resulting in pcDNA5 FRT/TO HA FLAG Ms Jaw1 PA and pcDNA5 FRT/TO HA FLAG Ms Jaw1 NIDR PA ...
-
bioRxiv - Immunology 2019Quote: ... Transduction of PBMCs with LV-GXM-CAR constructs was performed using RetroNectin reagent (Takara Bio USA; cat. no. T100A/B) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: Amplicons were gel-purified and ligated into a pOPIN-B vector digested with HindIII and KpnI using In-Fusion technology (Clontech). The primer sequences in low case correspond to adaptors pairing with the linearized vector ...
-
bioRxiv - Immunology 2021Quote: ... Following bulk BCR and TCR are prepared using SMARTer Mouse BCR IgG H/K/L Profiling Kit and SMARTer Mouse TCR a/b profiling kit separately (Takara). Based on the extracted mRNA amount of each sample ...
-
bioRxiv - Microbiology 2021Quote: ... 5′-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Immunology 2021Quote: ... 5’ s-RACE cDNA was obtained from bulk-sorted B cells of each mouse with the SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The IgG PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Cancer Biology 2019Quote: ... transfected cells were treated with 200 µg/mL hygromycin B (Nacalai Tesque, Kyoto, Japan) or 1 µg/mL puromycin (Clontech) for the selection of stably transfected cells.
-
bioRxiv - Cancer Biology 2020Quote: ... Both CnAOEC and ISO-HAS-B were cultured in Endothelial Cell Growth Medium 2 Kit (Takara Bio, Inc. Kusatsu, Japan). All cells used were routinely tested for Mycoplasma using PCR and were submitted to ICLAS Monitoring Center (Kawasaki ...
-
bioRxiv - Microbiology 2019Quote: ... 5’-RACE cDNA was obtained from bulk-sorted splenic B cells of each mouse with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The immunoglobulin PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Life Technologies ...
-
bioRxiv - Genetics 2021Quote: ... This plasmid was further used to generate backbone structure containing fust-1 promoter and mRFP, to which cDNAs of FUST-1 isoforms (isoform a, isoform b, and ΔN) were inserted by In-Fusion (Takara). The mRFP fused FUST-1 cDNA plasmids were used to generate cDNA only plasmids for splicing reporter rescue by removing the mRFP sequences using In-Fusion (Takara) ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then further into the ClaI site of the avian replication-competent retrovirus vector RCASBP(B) (Li, Monckton, & Godbout, 2014) with the In-Fusion HD cloning kit (Clontech). The mutant construct that converts glutamine (Q ...
-
bioRxiv - Microbiology 2020Quote: ... 5′-RACE cDNA was obtained from bulk-sorted B cells of each animal with SMART-Seq v4 Ultra Low Input RNA Kit for Sequencing (TaKaRa). The Ig PCRs were set up with Platinum Taq High-Fidelity DNA Polymerase (Thermo Fisher ...
-
bioRxiv - Immunology 2020Quote: ... 10ng of RNA was used to prepare bulk TCR-seq libraries using the SMARTer Mouse TCR a/b Profiling Kit (Takara) according to instructions ...
-
bioRxiv - Immunology 2023Quote: ... A cDNA library for TCR was prepared from RNA using a SMARTer Mouse TCR a/b Profiling Kit (Takara Bio) according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... cDNA libraries were generated using SMARTer Human TCR a/b Profiling Kit v2 (Takara Bio USA, San Jose, California, USA). Briefly ...
-
bioRxiv - Bioengineering 2023Quote: ... GA-MatryoshCaMP6s was amplified from pRSET B His-GA-MatryoshCaMP6s and subcloned into pDONR /Zeo via In-Fusion cloning (Takara Bio ...
-
bioRxiv - Neuroscience 2021Quote: Total mRNA was extracted from the hypothalamus using a TRIzol reagent according to the manufacturer’s instructions (Takara Biotechnology Co. Ltd, Dalian, China). RNA was reverse transcribed into cDNA using a cDNA reverse transcription kit (Catalog no ...
-
The pan-cancer lncRNA PLANE regulates an alternative splicing program to promote cancer pathogenesisbioRxiv - Cancer Biology 2020Quote: ... antisense PLANE and NCOR2 pre-mRNA were generated by PCR amplification from cDNAs using PrimerSTAR Max DNA Polymerase (TAKARA, #R045A; Dalian, China). Forward primers containing the T7 RNA polymerase promoter sequence and reverse primers without the promoter sequence were used for synthesizing PLANE ...
-
bioRxiv - Microbiology 2023Quote: ... The cells were cultured again overnight and subjected to the quantification of mRNA by qRT-PCR using the CellAmp Direct RNA Prep Kit for RT-PCR (Real Time) (3732, Takara Bio Inc.), One Step TB Green PrimeScript PLUS RT-PCR Kit (Perfect Real Time ...
-
bioRxiv - Molecular Biology 2023Quote: ... Accurate quantification of mRNA levels was meticulously conducted by employing the GAPDH reference gene and utilizing the cutting-edge SYBR Green kit (Takara, Kyoto, Japan) on the state-of-the-art Real-time PCR Detection System manufactured by Bio-Rad ...
-
bioRxiv - Cancer Biology 2020Quote: ... The primary antibody rabbit anti-human Cas9 Polyclonal Antibody (Clontech) was diluted 1 ...
-
bioRxiv - Microbiology 2019Quote: ... the fragments of the pcAGGS/pcDNA3.1 vector and each target gene were amplified with a 15 bp homologous arm and were then fused using the In-Fusion HD Enzyme (Clontech, Felicia, CA, USA). To create the pcAGGS-huANP32B-Δ216/190/165 plasmids ...
-
bioRxiv - Developmental Biology 2021Quote: ... Extent of SRY-dependent expression of β-galactosidase was evaluated by quantitative assay of enzyme activity in liquid culture using ortho-nitrophenyl-β-galactoside (ONPG) as described by the vendor (Clontech Laboratories, Inc). Mammalian Cell Culture—Rodent preSertoli-cell line ...
-
bioRxiv - Biochemistry 2021Quote: The amplified DNA products of the expected size were digested with the appropriate restriction enzymes and cloned into the pCOLD I expression vector (Takara Bio, Kusatsu, Japan), which allows for the production of proteins with an N-terminal His6 tag ...
-
bioRxiv - Plant Biology 2020Quote: ... About 2 μg of the isolated RNA was used to synthesize the first-strand cDNA using reverse transcriptase enzyme (Takara Bio, Clontech, USA). The cDNA was diluted seven times with sterile Milli-Q water (1:7 ratio) ...
-
bioRxiv - Biochemistry 2020Quote: ... Synthesized gene fragments went through cloning process after overnight digestion with restriction enzymes (Nde I, Xho I) at 37 °C and ligation (T4 DNA Ligase, Takara Bio, Shiga, Japan) into pET21 vector (Novagen ...
-
bioRxiv - Cell Biology 2023Quote: ... The synthesized sequences were ligated to an expression construct encoding a truncated form of OsPHR (Δ1-51OsPHR) using restriction enzyme cloning or InFusion cloning (InFusion HD Cloning kit, Takara Bio, Shiga, Japan). The modified PHR was cloned into the binary vector pMpGWB106 (Ishizaki et al. ...
-
bioRxiv - Cancer Biology 2024Quote: ... pHTN HaloTag® CMV-neo and pHTC HaloTag® CMV-neo were digested with restriction enzymes and subsequently ligated (Takara, cat n°6023). Primers and corresponding restriction digests can be found in Table S4 ...
-
bioRxiv - Microbiology 2021Quote: ... for 15 min and then harvested for quantification of INF α mRNA using the One-step SYBR Prime script RT-PCR kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol.Briefly the total RNA was isolated from TNF-α-treated with Trizol reagent (Takara Bio ...