Labshake search
Citations for Takara Bio :
101 - 137 of 137 citations for 9 Z 11 E 13 Z OCTADECATRIENOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: SARS-CoV-2 N and E genes were transcribed from the pBluescript-N and pUC57-E plasmids by adding a T7 promoter via PCR using Premix Taq (Cat. No. R004A, TAKARA, Shuzo, Shiga, Japan). The crRNA templates were amplified from a pUC57-T7-crRNA (Supplementary Table S10 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and the protein concentration was measured by a bicinchoninic acid (BCA) assay kit (Takara Bio) using bovine serum albumin as the standard ...
-
bioRxiv - Systems Biology 2023Quote: ... was used as the wild-type (WT) strain for genetic manipulations. Chemically competent Escherichia coli (E. coli) DH5α and HST08 (Stellar Competent Cells, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) were used as the host strains for molecular cloning.
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Full-length β-catenin and a C-terminal deletion of tle3b (NM_131780, complete reading frame after amino acid 210) were cloned in pGAD (Clontech). Combinations of plasmids to test two-hybrid interactions were co-transformed in Y2Gold yeast strain (Suppl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Microbiology 2019Quote: ... and N-glycolylneuraminic acid (NeuGc) released were labeled with 1,2-diamino-4,5-methylenedioxybenzene (DMB) using a commercial kit (Takara, Shiga, Japan). The DMB-labeled sialic acids were analyzed by HPLC equipped with a TSK-ODS80Ts column (Tosoh ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... For binding studies the 6xHis tag were removed from some Fabs by treatment with PreScission protease (MolBioTech; ThermoScientific) and the protein repurified on cobalt-nitrilotriacetic acid (Co-NTA) agarose (Clontech) followed by gel filtration chromatography on Superdex 200 (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... CPE 451 mCherry constructed by Gibson assembly by sub-cloning the 451 amino acids of CPE (without the Amphipathic Helix) into pmCherry-N1 (Clontech) vector using XhoI and BamHI restriction sites.As control vectors we used pEGFP-N3 and pmCherry-N1.All constructs were sequenced to confirm the fidelity of the process ...
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Synthetic Biology 2021Quote: ... which contains a six-amino acid His-tag for the creation of a N-terminal fusion using the In-Fusion HD cloning kit (Clontech, USA).
-
bioRxiv - Molecular Biology 2021Quote: ... two to three amino acids in GFP-SP-BAP were replaced by alanine for each construct using the CloneAmp HiFi PCR Premix (Takara Bio) according to the manufacturer.
-
bioRxiv - Biochemistry 2021Quote: ... Add 25 mL 200 g/L glucose and 25 mL 20 g/L amino acid drop-out mix (Clontech. Inc., Japan) solution to prepare the medium] ...
-
bioRxiv - Neuroscience 2022Quote: ... Pak1 fragment (amino acids 270–521) was PCR-amplified from pCMV6M-Pak1 and subcloned into pCold-Pros2 vector (Takara Bio Inc.) to generate pCold-Pros2-Pak1cat ...
-
bioRxiv - Immunology 2023Quote: ... The expression vectors for the S variants with multiple amino acid changes or deletions were generated using the In-Fusion HD cloning kit (Takara Bio). The pcDNA3.1-hACE2 used to express human ACE2 (hACE2 ...
-
bioRxiv - Neuroscience 2023Quote: ... lysates were centrifuged at 31,000 x g for 45 min at 4°C and the supernatant was mixed with nickel-nitrilotriacetic acid (Ni-NTA) beads (Takara, 635653) at 4°C for 2 h ...
-
bioRxiv - Biophysics 2019Quote: ... D40A mutation and deletion of C-terminal 10 amino acids were introduced into pET15-sfGFP-minD by using the PrimeSTAR Max mutagenesis protocol (TaKaRa, Shiga, Japan). Similarly ...
-
bioRxiv - Biophysics 2019Quote: ... The pCD86-EGFP had been created by inserting CD86 with a 21 amino acid linker coding region on its C-terminus immediately before EGFP in pEGFP-N1 (Clontech/Takara, Mountain View, CA). The CD86-21aa was amplified from pCD86-mEos2 (Mike Heilemann via Addgene ...
-
bioRxiv - Cell Biology 2019Quote: Amino acid substitutions in RNF167 were made using site-directed mutagenesis by Prime Star GXL-DNA polymerase (R050A, Takara Bio Inc., Otsu, Japan) according to the manufacturer’s protocol with the following primers:
-
bioRxiv - Biophysics 2019Quote: ... The pCD86-EGFP had been created by inserting CD86 with a 21 amino acid linker coding region on its C-terminus immediately before EGFP in pEGFP-N1 (Clontech/Takara, Mountain View, CA). The CD86-21aa was amplified from pCD86-mEos2 (Mike Heilemann via Addgene ...