Labshake search
Citations for Takara Bio :
401 - 450 of 573 citations for 8 Bromo 3 iodo quinoline since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2021Quote: ... Specific forward and reverse primers (Suppl Table 3) were designed using the In-Fusion Cloning Primer Design Tool from TaKaRa (https://www.takarabio.com/learning-centers/cloning/primer-design-and-other-tools ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting plasmids were co-transformed into Saccharomyces cerevisiae strain AH109 according to the protocols in the Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The yeast cells were cultured on SD/-Leu-Trp (-LW ...
-
bioRxiv - Molecular Biology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [18] (ii ...
-
bioRxiv - Genomics 2019Quote: ... These ligated pools were then amplified using AdR_PCR oligonucleotides as primer (5′ -GGTCGCGGCCGAGGATC-3′) (IDT) and Advantage cDNA polymerase mix (Clontech, 639105). Amplicons were electrophoresed in 1% agarose gel to check for amplification and the size distribution of the library and then column purified (Qiagen ...
-
bioRxiv - Genomics 2019Quote: ... reverse transcription was initiated from the bridge 3’ OH by adding 2 μL SMARTScribe Reverse Transcriptase (100 U/ μL, Clontech) and incubating for 1 h at 42 °C with shaking at 800 rpm ...
-
bioRxiv - Pathology 2020Quote: ... The PCR assay was conducted as described previously9 and the complete genome termini was determined using the Takara SMARTer RACE 5’/3’ kit (TaKaRa) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: Three specific 5’ RACE primers and two 3’ RACE primers were designed according to the Race kit instructions (Invitrogen & Clontech) (Table S1) ...
-
bioRxiv - Microbiology 2019Quote: ... Primers P5 and P6 were annealed to create a dsDNA molecule encoding the sgRNA sequence with 5’ and 3’ extensions to enable InFusion Cloning (Clontech) into BtgZI-digested pL6 ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral particles were concentrated from supernatant by mixing 3 parts supernatant with 1 part Lenti-X concentrator solution (ClonTech 631231), incubating overnight at 4 °C ...
-
bioRxiv - Developmental Biology 2019Quote: ... 5’ and 3’ RACE was carried out according to the manufacturer’s protocol of SMART RACE cDNA Amplification kit (Clontech, Takara, Japan). The sequences of primers for RACE are as follows ...
-
bioRxiv - Molecular Biology 2019Quote: ... interaction test and plasmid isolation were performed using the Yeast Protocols Handbook and Matchmaker GAL4TM Two-hybrid System 3 & Libraries User Manual (Clontech).
-
bioRxiv - Microbiology 2021Quote: ... CPER fragments containing WT or mutated or 3’UTRs were amplified from the plasmids using PrimeStar GXL polymerase (Takara, Japan) and gel-purified ...
-
bioRxiv - Plant Biology 2020Quote: ... The 5’-3’ junction sequence was amplified by PCR with cox1 specific primers Atcox1-5’(−176..-196) and Atcox1-3’(+17..+38) using Ex Taq Hot Start Version (Takara). The thermal cycling program consisted of initial 4 minute-denaturation at 95°C ...
-
bioRxiv - Microbiology 2021Quote: Evaluation of protein interactions by the GAL4-based Y2H system was performed by following the manufacturer’s recommendations for the Matchmaker GAL4 Two-hybrid System 3 (Clontech, USA). Competent AH109 yeast cells (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described [3] ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Neuroscience 2021Quote: ... DNA fragments for both 5’- and 3’-homologous arms were amplified using PrimeSTAR GXL DNA polymerase (TaKaRa Clontech cat# R050) from the genome DNA of Canton-S wild-type strain of D ...
-
bioRxiv - Biophysics 2020Quote: Target DNA containing the 5′-TTTA-3′ PAM was ordered from IDT and cloned into a pET28-MHL vector using the In-Fusion Cloning Kit (ClonTech). Plasmids were linearized before usage ...
-
bioRxiv - Cell Biology 2021Quote: ... Semi-quantitative PCRs (sqPCRs) were performed on 3 μl of cDNA template using Emerald Amp Max PCR Master Mix (Takara). The sequences of the primers used for PCR amplifications are included in Supplemental Table 4.
-
bioRxiv - Plant Biology 2022Quote: ... and pMKMM21 (3.5 kb upstream SYP12A:5’UTR:miniTurbo- Myc-SYP12A:3’UTR) were generated by in-fusion cloning (HD enzyme mix; Takara Bio). Gateway binary vectors pMKMM22 and pMKMM23 for the expression of miniTurbo-Myc- MpSYP13B and miniTurbo-Myc-MpSYP12A were generated by LR-recombination (LR clonase ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Neuroscience 2020Quote: ... cerevisiae strains used for yeast two-hybrid analysis were Y187 (MATα, ura3-52, his3-200, ade2-101, trp1-901, leu2-3, 112, gal4Δ, met–, gal80Δ, URA3::GAL1UAS-GAL1TATA-lacZ; Clontech) and Y2H Gold (MATa ...
-
bioRxiv - Plant Biology 2021Quote: ... medium and 10-fold dilutions of these cultures were dropped on SD control (−2) and selective medium additionally lacking His (−3) (Clontech). Empty vectors were used as negative controls ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sgRNA target locus on exon 3 or 5 was PCR amplified with Terra™ PCR Direct Polymerase Mix (Takara) for 35 cycles using primer sets mEX3F and mEX3R or mEX5F and mEX5R (Table 1) ...
-
bioRxiv - Genomics 2021Quote: ... These nanowells were selected for subsequent targeted deposition of 50□nl/nanowell RT-PCR reaction mix from the SMARTer ICELL8 3’ DE Reagent Kit (Takara) using the MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... 5’-GGC ATG GAC GAG CTG TAC AAG TCC AAT TTA CTG ACC GTA CAC-3’ and on pEGFP-C1 (Clontech) with primer ...
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and ΔRST (missing the residues 462-589) deletions were introduced by PCR using primers listed in Supplementary table 3 and end-joining using In-Fusion (Takara).
-
bioRxiv - Microbiology 2022Quote: ... A second construct for total gene deletion was generated by cloning the 5’ (843 bp) and 3’ (292 bp) homology regions amplified by PCR using a Taq DNA polymerase with proofreading activity (Takara) and primers P9 + P12 and P13 + P14 into the pL0001 vector (BEI Resources ...
-
bioRxiv - Microbiology 2022Quote: ... and McGee_sabB_rev (5’ atcgataagcgaattcttaataagcaaacacataattgagatacacgctataaagc 3’) and cloned into the pDYC40 plasmid that contains a kanamycin resistance cassette 55 via In-Fusion cloning (Takara). This plasmid is designed for complementation at a previously characterized ...
-
bioRxiv - Systems Biology 2022Quote: ... Optimized coding sequences were synthesized as gBlocks (Integrated DNA Technologies) carrying 16-base pair overhangs at the 5’ and 3’ ends to facilitate in-fusion cloning (Clontech) into pET expression vectors (EMD MIllipore).
-
bioRxiv - Genomics 2022Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adaptor with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described (Zhu et al. ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... magnanima was assessed by PCR amplifying a cifB-like gene (Extended Data Table 3) in the WOwHm-t76 region with the Emerald Amp Max Master mix (TaKaRa) at 94°C for 3 min ...
-
bioRxiv - Neuroscience 2022Quote: Total RNA was prepared from cortical samples from control and cKO animals (3 animals/group) by using RNAiso-plus kit (Takara) and according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... reverse transcription of the RNA using a primer designed to the constant region of the barcoded adapter with addition of an adapter to the 3’ end of the cDNA by template switching using SMARTScribe (Clontech) as described previously 32 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Confirmatory “1-to-1” pairwise assays for selected interactants were performed with the MatchMaker Two-Hybrid System 3 (Clontech Inc.)
-
bioRxiv - Pathology 2020Quote: ... 3’-RACE-PCR was performed as per the instructions of SMARTer™ RACE-cDNA Amplification Kit User Manual (Clontech, 2012) using primers given in Table 1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The N-terminal 3X-FLAG-tagged ThPOK expression plasmid was generated by cloning the ThPOK coding DNA sequence (CDS) in the backbone of pEGFPC-3 (Clontech) plasmid after replacing the CDS of EGFP with 3X-FLAG ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Cell Biology 2019Quote: ... TRPV4(ΔPR)–myc and TRPV4(ΔAR1-3)–myc were constructed using PCR with template plasmids from Open Biosystems subcloned into pCMV-myc vector (Clontech) at the SalI/XhoI sites ...
-
bioRxiv - Plant Biology 2020Quote: ... Membrane blocking was performed with 3%BSA in PBS-t buffer for 1 h at room temperature followed by incubation with Mouse-anti-GFP (TaKaRa) (1/5,000 ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... MEL1 and lacZ) under distinct GAL4 upstream activating sequences as described in Matchmaker GAL4 Two-Hybrid System 3 & Libraries User Manual (Clontech). The transformants were grown on synthetic dropout (SD ...
-
bioRxiv - Genomics 2019Quote: SiGRF1 protein interactions were investigated by screening a foxtail millet cDNA library in yeast with the Matchmaker Two-Hybrid System 3 (Clontech). SiGRF1 cDNA without the termination codon was cloned with EcoR1 technology in pGBKT7 ...
-
bioRxiv - Plant Biology 2019Quote: Rapid amplification of 5’ cDNA ends (5’RACE) of CREF3 transcripts was performed using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... The cDNA was generated through a 3’-RACE-Ready cDNA synthesis reaction using the SMARTer RACE cDNA amplification kit (Clontech), following the user manual ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...