Labshake search
Citations for Takara Bio :
501 - 550 of 1068 citations for 8 9 5 α CHOLESTEN 24 METHYLENE 3 β OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: Bacterial expression plasmids encoding mouse and human WT-α-synuclein in the inducible pRK172 backbone were transformed into BL21-CodonPlus (DE3) cells (Clontech). Cell pellets were lysed in 0.75M NaCl ...
-
bioRxiv - Plant Biology 2020Quote: ... 3-μL aliquots of each dilution were used to inoculate SD/−Trp/−His/−Ade medium and SD/−Trp/−His medium with X-α-Gal (Clontech). The inoculated media were incubated for 4 days at 30 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Single-round replication-incompetent HIV-1 produced from J-Lat-EnTr cells was harvested 48hr post TNF-α treatment and concentrated via Lenti-X-Concentrator (Clontech). J-Lat-EnTr-BFP cells co-cultured with Jurkat-GFP cells produced single-round replication-incompetent HIV-1 produced via TNF-α treatment for 72hr ...
-
bioRxiv - Microbiology 2021Quote: ... according to the manufacturer’s protocol.Briefly the total RNA was isolated from TNF-α-treated with Trizol reagent (Takara Bio, Daian, China). cDNA was synthesized from 1 μg of total RNA with Prime Script II (Takara Bio ...
-
bioRxiv - Plant Biology 2023Quote: ... qRT-PCR was performed with GeneAce SYBR qPCR Mix α No ROX (Nippon Gene, Tokyo, Japan) in Thermal Cycler Dice Real Time System II (Takara). Each Actin1 genes (PtActin1 and TpActin1 ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were then run on a 4-12% Bis-Tris gel and transferred to a membrane for western blotting using α-GFP (Clontech) and α-HA (Cell Signaling Technology ...
-
bioRxiv - Biochemistry 2022Quote: ... with (GGGGS)3 linker using In-Fusion HD Cloning Kit (Takara). Plasmids to express CAHS deletion mutants (CAHS3ΔCtail ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Microbiology 2021Quote: ... and NCIMB8826R using the pts1BCA_trunF (5’-TCGTCACCGAGTGTTCGTTT) and pts1BCA_trunR (5’-AGTTGCTGGCCACTGTTCAT) primers (Table S8) and ExTaq DNA polymerase (TaKaRa, Shiga, Japan). Thermal cycling conditions were as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... dsDNAs were amplified by PCR using modified primers with 5’Bioton – 5 x phosphorothioate bonds (synthesized by eurofins) and PrimeSTAR Max (Takara).
-
bioRxiv - Microbiology 2019Quote: ... and then prehybridized in 5 mL ExpressHyb (ClonTech) for 1 hour at 65°C ...
-
bioRxiv - Genetics 2019Quote: ... containing 5 μL 2X SYBR master mix (Takara), 30ng genomic DNA ...
-
bioRxiv - Microbiology 2020Quote: ... 0.5 μl 5 U/μl Taq polymerase (Takara) and nuclease-free water to 30 μl ...
-
bioRxiv - Developmental Biology 2020Quote: ... and once in 5 ml NDiff227 (Takara Y40002). mESCs were then pelleted by centrifugation for 5’ at 1000rpm and resuspended in 500µl of NDiff227 ...
-
bioRxiv - Molecular Biology 2023Quote: 5 ml TALON metal affinity resin (TaKaRa Bio) was equilibrated with five column volumes of native lysis buffer ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl 5× In-Fusion Enzyme Mix (Takara) were mixed in a total of 5 µl H2O ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U/µL Ex Taq polymerase (TaKaRa, Japan), 20 mg/mL BSA (Roche ...
-
bioRxiv - Biochemistry 2023Quote: ... 5 mM ATP (Takara, sodium salt, pH 7.0), and 0.5 mM NADPH (Roche ...
-
bioRxiv - Immunology 2022Quote: ... 1 mL of retroviral supernatant was added to a non-tissue culture-treated 24-well plate pre-coated with Retronectin (FN CH-296; Takara Shuzo, Otsu, Japan) and centrifuged for 90 min at 2000×g ...
-
bioRxiv - Molecular Biology 2022Quote: ... Finally RNA was isolated from the eluates by phenol-chloroform-Isoamyl alcohol (25:24:1) pH 4.5 extraction and cDNA was prepared using 1st strand cDNA synthesis kit (Takara Bio Inc., Shiga, Japan) as described in above RNA analysis section ...
-
bioRxiv - Microbiology 2023Quote: The FLAG-vPOL construct was generated by amplifying the MHV68 vPOL from the recombinant MHV68 M3-Luc bacterial artificial chromosome (BAC) (39) with PCR followed by insertion in the p3xFLAG-Myc-CMV-24 vector (CloneTech Takara Biotech, Mountainview, CA) at the EcoRI and SalI restriction sites ...
-
bioRxiv - Immunology 2023Quote: ... M-IgA was expressed by transfecting a pair of alpha heavy and kappa light chain genes into FreeStyle CHO-S cells that were grown in a 24-well plate according to the manufacturer’s protocol (CHOgro High Yield Expression System, Takara Bio, Shiga, Japan). For large-scale antibody production ...
-
bioRxiv - Biochemistry 2024Quote: ... Sub-library specific primers were then used to amplify 1 ul of cDNA template for 24 cycles using Advantage 2 PCR Mix (Takara Bio, Cat. 639206). Finally ...
-
bioRxiv - Plant Biology 2019Quote: ... proteins were transferred to PVDF membrane and blotted proteins were incubated in a 1:10,000 dilution of mouse monoclonal anti-GFP antibody (Living Colors JL-8, Clontech) followed by 1:5000 horseradish peroxidase conjugated sheep anti-mouse IgG antibody (Amersham ...
-
bioRxiv - Neuroscience 2021Quote: ... RNA samples with RIN values >8 were used for library preparation according to manufacturer’s instructions (SmartSeqv4 RNASeq kit, Clontech) or manual library preparation for Ampliseq analysis (Ion AmpliSeq Lib Kit Plus) ...
-
bioRxiv - Microbiology 2021Quote: ... H6-Gfp-FtsZ and FtsZ were mixed in a 1:1 ratio for a final concentration of 8 µM in assembly buffer with GMPCPP (0.2 mM) and resuspended Talon Cobalt beads (Takara) and added ...
-
bioRxiv - Molecular Biology 2019Quote: ... PCR products were gel purified (Machery Nagel) and used to generate α-32P dCTP-labeled probes using the Random Prime Labeling Kit (Takara/Clontech). Probes were purified over nucleotide purification columns (Zymo Research ...
-
bioRxiv - Plant Biology 2022Quote: ... His (SD/-Trp/-Leu/-Ade/-His) and with sprayed 100 µl of 4 mg/ml X-α-Gal (Takara Bio, CA, USA) in dimethylformamide on plates (SD/-Trp/-Leu/-His/X-α-Gal) ...
-
bioRxiv - Cell Biology 2023Quote: ... KOD FX DNA polymerase (TOYOBO) and primers (supplementary table 1) and then cloned into the BamHI site of pLVSIN-EF1 α Hyg vector (Takara Bio) using an In-Fusion HD Cloning Kit (Takara Bio) ...
-
bioRxiv - Plant Biology 2023Quote: ... and on a SD-Leu-Trp-Ade-His plate containing X-α-gal and supplemented with 0.2 µg/ml Aureobasidin A (Takara Bio, USA). Plates were imaged after incubation for 60–72 hr at 30 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... forward = TTTCTAAGACTCTCTCCCGTA and reverse = GATTAGAAGTAGCCGACCAA) was labeled with dCTP [α-32P] using Random Primer DNA Labeling Kit Ver.2.0 (Takara, catalog #6045). The hybridization was done at 65°C overnight in Church and Gilbert Moderate Hybridization Buffer (1% BSA ...
-
bioRxiv - Genomics 2021Quote: ... and then dispensed into a barcoded SMARTer ICELL8 3’ DE Chip (Takara) by an ICELL8 MultiSample NanoDispenser (MSND ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the Nextera Primer P5 (ICELL8® 3’ DE Kit, Takara Bio), Nextera XT DNA Library Preparation Kit (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... 3′RACE was performed using SMARTer RACE cDNA Amplification Kit (Takara Bio) per the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... and the supernatant was mixed with Ni-NTA resin (Clontech, 3 mL) and kept on a rocker at RT for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Mutated 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Cell Biology 2021Quote: Ad vectors were constructed using Adeno-XTM Adenoviral System 3 (Takara Bio). The ACE2 and TMPRSS2 genes were amplified by PCR using cDNA generated from Pulmonary Alveolar Epithelial Cell Total RNA (ScienCell Research Laboratories ...
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Cancer Biology 2023Quote: ... The virus particles were collected 24 hours and 48 hours after transfection and concentrated with Lenti-X™ Concentrator (Takara, California, USA, Cat#631232). The pellets were then resuspended with PBS ...
-
bioRxiv - Microbiology 2023Quote: ... RNA was extracted from the injected aphid nymphs 24 h post-injection using the Takara Nucleospin RNA Plus XS RNA extraction kit (Takara Bio Inc., Shiga, JP). For RNA extraction ...
-
bioRxiv - Cell Biology 2020Quote: ... To detect the transgenic GFP-tagged Abl proteins we used anti-GFP (JL-8, 1:500 or 1:1000, Clontech). Anti-αTubulin (Sigma ...
-
bioRxiv - Molecular Biology 2019Quote: ... Same volume of samples were loaded on 4-16% gradient SDS-PAGE gels and analyzed by western blot analysis using EGFP (JL-8; Clontech), penta-HIS (QIAGEN ...
-
bioRxiv - Cell Biology 2021Quote: ... cells were stably transfected with a plasmid encoding human full-length keratin 8 with an EYFP tag at its carboxyterminus (Windoffer et al., 2004; recloned into pEYFP-N1 (Clontech) with BamHI and EcoRI) ...
-
bioRxiv - Microbiology 2020Quote: ... Proteins induced by 1 mM IPTG entered inclusion bodies and were extracted with 8 M urea and purified with TALON Metal Affinity Resin (Takara) under denaturing conditions ...
-
bioRxiv - Developmental Biology 2019Quote: ... 10 ng total RNA was reverse transcribed and full-length cDNA was specifically amplified by 8 PCR cycles using SMART-Seq v4 Ultra Low Input RNA Kit (Clontech) (31) ...
-
bioRxiv - Cell Biology 2022Quote: ... The samples were subjected to 4-20% SDS-PAGE and analyzed by immunoblotting with the following primary antibodies: anti-GFP mouse monoclonal antibody (JL-8, Takara), GFP rabbit polyclonal antibody (PABG1 ...
-
bioRxiv - Biophysics 2022Quote: ... The stability of the fusion constructs was verified by gel electrophoresis and immunoblotting using an anti-GFP primary antibody (JL-8 monoclonal, Takara). Point mutations were introduced by site-directed mutagenesis (New England Biosciences) ...