Labshake search
Citations for Takara Bio :
1 - 50 of 1984 citations for 8 phenylamino 5 4 5 sulpho 1 naphthyl azo 1 naphthyl azo naphthalene 1 sulphonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... anti-GFP (Clontech, JL-8, 1:10,000 in 5% non-fat milk) and anti-GAPDH (Millipore ...
-
bioRxiv - Plant Biology 2021Quote: ... Membranes were blocked with 5% milk overnight at 4°C or 1h at room temperature for Anti-GFP JL-8 (1:4000; Clontech, California ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl 5× In-Fusion Enzyme Mix (Takara) were mixed in a total of 5 µl H2O ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Neuroscience 2023Quote: ... the mouse monoclonal anti-GFP (Jl-8, Clontech; 1:500 overnight at 4°C) primary antibody was used ...
-
bioRxiv - Neuroscience 2024Quote: ... GFP (1:1,000, JL-8, Clontech), GABARAP/Atg8a (1:2,000 ...
-
bioRxiv - Developmental Biology 2022Quote: ... mouse GFP (1:200, JL-8, Clontech) gp anti-Verm (Wang et al. ...
-
bioRxiv - Microbiology 2020Quote: ... 1) were annealed to a complementary 20-nt primer containing a 5’-fluorescein label (5’FAM-GUCAUUCUCCUAAGAAGCUA-3’, Takara). To perform the primer extension assay ...
-
bioRxiv - Biophysics 2024Quote: ... The supernatant was then diluted 1:5 to improve binding efficiency and incubated overnight on the rotisserie at 4°C with TALON Cobalt Resin (Takara Bio). The next day the resin was washed with 10 column volumes of Membrane Buffer 1 ...
-
bioRxiv - Genetics 2021Quote: 1:500 mouse anti-GFP (Takara, JL-8)
-
bioRxiv - Cell Biology 2021Quote: ... Mouse Anti-GFP (1:1000; JL-8, Clontech). Blots were washed three times with PBST and probed with secondary antibodies diluted in PBS with 1% milk and 1% BSA for one hour at 4°C ...
-
bioRxiv - Physiology 2019Quote: ... Membranes were incubated at 4°C in primary antibodies diluted 1:1000 in 5% bovine serum albumin: anti-GFP (ClonTech Living Colours #ab632375), anti-HSP60 (Department of Biology ...
-
bioRxiv - Neuroscience 2020Quote: ... 0.125 μl Takara Ex Taq DNA Polymerase (5 U μl-1) (TaKaRa, Shiga, Japan), 2 μl of DNA and 15.67 μl nuclease-free water ...
-
bioRxiv - Cell Biology 2022Quote: ... monoclonal anti-GFP JL-8 (1:1000, Clontech 632380), polyclonal rabbit anti-RP2 (1:1000 ...
-
bioRxiv - Cell Biology 2022Quote: Primary antibodies against GFP (Clontech, JL-8; 1:5000), G-6-PDH (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2019Quote: ... Primary Antibodies: anti-GFP (JL-8; Clontech, 1:1000), anti-Flag (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq, TaKaRa Bio, Shiga, Japan), 2.5 µL PCR Buffer 10X ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), rabbit anti-GFP (Chromotek ...
-
bioRxiv - Cell Biology 2021Quote: ... mouse anti-GFP (Clontech, JL-8, 1:5000 for western), mouse anti-Dhc (Developmental Studies Hybridoma Bank ...
-
bioRxiv - Neuroscience 2023Quote: ... Green Fluorescent Protein (GFP) antibody (JL-8, 1:500, Clontech), Red Fluorescent Protein Antibody (DsRed ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sections were blocked in 5% goat serum then incubated with primary antibody at 4°C overnight (anti-dsRed for tdTomato (632496, 1:1000; Takara Bio, Mountain View, CA, USA), anti-SP7 (ab22552 ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Microbiology 2020Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 ml HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into Cytiva 1x HBS- N buffer or PBS.
-
bioRxiv - Microbiology 2021Quote: ... SARS-CoV-2 RBDs were purified using 1 or 5 mL HisTALON superflow cartridges (Takara Bio) and subsequently buffer exchanged into 1x HBS-N buffer (Cytiva ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Bioengineering 2023Quote: ... Cerulean and Myo7b blots were stained for 1 h at room temperature (RT) or overnight at 4 °C using the mouse anti-GFP (detects cerulean, 1:2000, JL-8, Clontech, Takara) and the mouse anti-β-tubulin antibody (1:500 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... anti-GFP (JL-8, 1:3000, Clontech, Saint-Germain-en-Laye, France) and anti-Actin (AC74 ...
-
bioRxiv - Cell Biology 2020Quote: ... To detect the transgenic GFP-tagged Abl proteins we used anti-GFP (JL-8, 1:500 or 1:1000, Clontech). Anti-αTubulin (Sigma ...
-
bioRxiv - Cell Biology 2019Quote: Chimeras 1-5 were first generated in pBluescript by In-Fusion cloning (Takara Bio, USA, Mountain View, CA) of inserts encoding different fragments of human Myo1e PCR-amplified from pEGFP-C1-myo1e-EcoR1-into the PCR-amplified segments of pBS-SpMyo1 vector using primers designed to replace selected SpMyo1 domain sequences with corresponding HsMyo1e sequences ...
-
bioRxiv - Genomics 2023Quote: ... Primary antibodies were diluted in 5% milk in PBS-T + 0.01% sodium azide (1:2,000 for mouse anti-GFP (Clontech) and mouse anti-3V5 (Invitrogen) ...
-
bioRxiv - Cell Biology 2019Quote: ... for 30 min at 37°C in a moisture chamber followed by an incubation with anti-GFP (1:100 in PBSA) antibody at 4°C for 72 h (Takara 632381/JL-8)) ...
-
bioRxiv - Microbiology 2020Quote: ... Immunoblots were probed with mouse anti-GFP (1:10,000 JL-8, Clontech #632380) and rabbit anti-β-actin (1:10,000 Cell Signaling #4967 ...
-
bioRxiv - Genomics 2021Quote: ... or SL medium (for E14-STNΔTsixP) and transduced the next day with 1ml of 5:1 concentrated (lenti-X, Clontech) and filtered viral supernatant with 8 ng/µl polybrene (Sigma Aldrich) ...
-
bioRxiv - Immunology 2021Quote: ... 100,000 cells were sorted into 200 uL PBS with 1 uM DTT and 5 uL RNase Inhibitor Cocktail (Takara); for ex vivo culture experiments ...
-
bioRxiv - Microbiology 2022Quote: ... A 5 µl aliquot was removed from each sample for immunoblots using mouse anti-GFP (1:5,000, Clontech #632381) to detect A3-EGFP ...
-
bioRxiv - Cell Biology 2020Quote: ... with the following primers (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatg) or (forward 5’ GAATTCAGATCTATGGTGAGCAAGGGCGAGGAG and reverse 5’ gaattcagatctcttgtacagctcgtccatgccg) using pEGFP (Clontech) or pCMV-mCherry2 (Clontech ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA libraries were prepared using 1-5 ng of starting material using the SMARTer ThruPLEX DNA-Seq kit (Takara; R400674) according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... sperm from 15 flies were dissected and pooled in 1:10 dilution of RNAse inhibitor (Recombinant ribonuclease inhibitor 5 000 U, Cat. 2313A Takara), and samples were flash-frozen on dry-ice ...
-
bioRxiv - Microbiology 2019Quote: ... A plasmid encoding a gene fusion between the 5‘-201 nucleotides of PR8 segment 5 and GFP was made by PCR-cloning the appropriate IAV sequence into pEGFP-1 (Clontech), followed by oligonucleotide-directed PCR mutagenesis (using standard protocols ...
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Genetics 2020Quote: ... The target vector and pEF1a-pac vector were co-transfected (5:1 ratio) to E14 mESCs using Xfect according to the manufacture’s instruction (TaKaRa, Inc). 48 hours after transfection ...
-
bioRxiv - Molecular Biology 2022Quote: ... The cDNAs (1-5 ng RNA equivalents) were used for real-time PCR amplification using SYBR Premix Ex Taq II (Takara/Clontech) on a 7500 Fast Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2019Quote: ... Antibodies used for this study were: mouse anti-GFP JL-8 (Clontech, 1:3000), rabbit anti-PfEF1α (from D ...
-
bioRxiv - Plant Biology 2020Quote: ... mTurq2cp was immunodetected with anti-GFP antibody (1:4000 dilution) (JL-8, #632380, Takara) and anti-mouse-HRP (1:15000 dilution ...
-
bioRxiv - Cell Biology 2023Quote: ... The following primary antibodies were used: mouse anti-GFP JL-8 (1:1000; TaKaRa), mouse anti-Tubulin AA4.3-c (1:5000 ...