Labshake search
Citations for Takara Bio :
351 - 400 of 1158 citations for 8 5 HEXYL 2 FURYL OCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: ... 2 μg/ml doxycycline (Clontech, cat. no. 631311), 1X N2 supplement (Life Technologies ...
-
bioRxiv - Immunology 2023Quote: ... Kit Advantage 2 PCR Enzyme System (Clontech, 639206), QIAquick Gel Extraction ...
-
bioRxiv - Microbiology 2024Quote: ... 2 µL of PrimeSTAR GXL DNA polymerase (Takara), 200 uM of each dNTP ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Immunology 2020Quote: ... and mCherry was amplified from pTRE-Dual2 (Clontech # PT5038-5). pAF137 was constructed by amplifying the devil 41BB extracellular domain with primers pAF137-1.FOR and pAF137-1.REV and amplifying mCherry with pAF137-2a.FOR and pAF137-2.REV (Table S3-4) ...
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Genomics 2019Quote: ... The Agilent 2100 Bioanalyzer was used to assess RNA quality and only high-quality RNA (RIN > 8) was further processed for cDNA synthesis with SMART-Seq v4 Ultra Low Input RNA Kit (Clontech cat. 634888) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µg of high-quality total RNA (RNA integrity number > 8) was fragmented in the presence of Mg2+ in SMARTScribe Reverse Transcriptase buffer (Clontech, Cat. 639537), and mRNA fragments with a poly(A ...
-
bioRxiv - Neuroscience 2023Quote: ... Arr3 and Arr3-derived constructs were detected with rabbit anti-Arr3 (Ahmed et al., 2007) or mouse anti-GFP (Clontech JL-8) antibody ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Microbiology 2019Quote: ... and N-glycolylneuraminic acid (NeuGc) released were labeled with 1,2-diamino-4,5-methylenedioxybenzene (DMB) using a commercial kit (Takara, Shiga, Japan). The DMB-labeled sialic acids were analyzed by HPLC equipped with a TSK-ODS80Ts column (Tosoh ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Immunology 2020Quote: ... For binding studies the 6xHis tag were removed from some Fabs by treatment with PreScission protease (MolBioTech; ThermoScientific) and the protein repurified on cobalt-nitrilotriacetic acid (Co-NTA) agarose (Clontech) followed by gel filtration chromatography on Superdex 200 (GE Healthcare ...
-
bioRxiv - Cell Biology 2021Quote: ... CPE 451 mCherry constructed by Gibson assembly by sub-cloning the 451 amino acids of CPE (without the Amphipathic Helix) into pmCherry-N1 (Clontech) vector using XhoI and BamHI restriction sites.As control vectors we used pEGFP-N3 and pmCherry-N1.All constructs were sequenced to confirm the fidelity of the process ...
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).
-
bioRxiv - Pathology 2021Quote: ... The number of SARS-COV-2 copies were quantified using Direct One-Step RT-qPCR Mix for SARS-CoV-2 kit (Takara Bio Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... and 2 μg/ml Doxycycline (Clontech; Cat. No. 631311). iTF-iPSCs were counted and seeded onto double coated plates (Poly-D-Lysine-precoated Bio plates (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 ug/mL doxycycline (Clontech, Cat. No. 631311). i3Neurons were then fed three times a week by half media changes ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 2 μL of 5X SMARTScribe RT buffer (Takara), 0.5 μL of 100 mM DTT (Millipore Sigma) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR amplification used 2×PrimeSTAR Mix (Takara, Japan). The target dsDNA fragments for titration experiments were quantified using a PikoGreen dsDNA Quantitative Kit (Life iLab Biotech ...
-
bioRxiv - Zoology 2021Quote: ... 10 μL of 2×SYBR Green Premix (Takara, Japan), and 6.8 μL ddH2O ...
-
bioRxiv - Microbiology 2021Quote: ... followed by selection with 2 μg/ml puromycin (Clontech). (For the sequences of shSIRT6 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 2× SYBR Green qPCR Mix Kit (TaKaRa, Japan) and the cDNA concentration and primers described above were used ...
-
bioRxiv - Immunology 2022Quote: ... before amplification using the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Bioengineering 2023Quote: ... quantified via qPCR (AAVpro Titration Kit version 2; Clontech), and stored at 4°C until use.
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Immunology 2023Quote: ... before whole transcriptome amplification using Advantage 2 Polymerase (Clontech) using oligos that introduce Illumina Nextera Multiplex Identifier (MID ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the Advantage® 2 PCR Kit (Takara Bio) in a touchdown cycling program as follows ...
-
bioRxiv - Cell Biology 2019Quote: ... for 30 min at 37°C in a moisture chamber followed by an incubation with anti-GFP (1:100 in PBSA) antibody at 4°C for 72 h (Takara 632381/JL-8)) ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected with relevant siRNA were seeded on to 8–well chamber slides and treated with 1 μM Sheild1 (632189, Clontech Laboratories UK Ltd) and 1 μM 4–hydroxytamoxifen (4–OHT ...
-
bioRxiv - Genetics 2019Quote: ... and performed the 2nd round of PCR to attach to the libraries adaptor and index sequences for the NGS analysis for 8 cycles again with Tks Gflex™ DNA Polymerase (Takara, Cat#R060A). The DNA sequences of the adaptor/index primers are listed in Table S6 ...