Labshake search
Citations for Takara Bio :
201 - 250 of 2130 citations for 7H Pyrazolo 4 3 d pyrimidin 7 one 1 4 dihydro 3 b D ribofuranosyl oxime monohydrochloride 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: The dn-VAMP2/3 constructs were assembled by InFusion cloning (Takara Bio) to anneal three DNA fragments in a pAAV vector backbone ...
-
bioRxiv - Molecular Biology 2023Quote: ... Cleared lysates were applied to 3 mL TALON Metal Affinity Resin (Takara) and incubated for 30 minutes at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... The Matchmaker two-hybrid system 3 (Clontech Laboratories, Mountain View, CA, USA) was used for the yeast two-hybrid assay ...
-
Striated muscle-specific base editing enables correction of mutations causing dilated cardiomyopathybioRxiv - Genetics 2022Quote: The lentivirus (generation 3) was produced in Lenti-X 293 cells (Takara) by transfecting the four plasmids with linear PEI (polyethylenimine ...
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Biochemistry 2021Quote: ... then incubated at 4 °C in Lenti-X Concentrator (Clontech) for 1 h ...
-
bioRxiv - Genomics 2023Quote: ... 4 µl of Dr.GenTLE precipitation carrier (Takara, cat. no. 9094) and 4 µl sodium acetate ...
-
bioRxiv - Microbiology 2019Quote: ... the NS3 fragments with FLAG-tag and NS3 cDNA vector were ligated together at an approximate molar ratio of 1:3 using TaKaRa DNA Ligation Kit LONG (TAKARA) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2019Quote: ... Lentiviral particles were concentrated from supernatant by mixing 3 parts supernatant with 1 part Lenti-X concentrator solution (ClonTech 631231), incubating overnight at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... was co-transformed with different bait-prey combinations as indicated in Extended Data Fig.1 in accordance with instructions for Matchmaker GAL4 Two-Hybrid System 3 (Clontech). The transformed yeast was then screened in 4-dropout plates for the protein-protein interaction.
-
bioRxiv - Immunology 2022Quote: ... First-strand cDNA was generated from 1 μg of RNA for each sample using the SMARTer RACE 5’/3’ Kit (Takara Bio ...
-
bioRxiv - Plant Biology 2020Quote: ... Membrane blocking was performed with 3%BSA in PBS-t buffer for 1 h at room temperature followed by incubation with Mouse-anti-GFP (TaKaRa) (1/5,000 ...
-
bioRxiv - Molecular Biology 2020Quote: ... To purify the probes, 1/3 of the transcription reaction was loaded on a pre-spun (700xg, 5minutes) Chromaspin-100 column (Clontech) and centrifuged (700g ...
-
bioRxiv - Immunology 2022Quote: ... Sequences encoding DCFHP (residues 1-1146 of HexaPro)2 and SΔC-Fer (residues 1-1143 as previously described)3 were cloned into the pADD2 vector backbone using HiFi PCR (Takara) followed by In-Fusion (Takara ...
-
bioRxiv - Plant Biology 2020Quote: ... which contained 4 µL of lysis buffer with 1 U/µL of Recombinant RNase Inhibitor (RRI, Clontech 2313B), 0.1% [w/v] Triton X-100 (Thermo Scientific 85111) ...
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Plant Biology 2023Quote: ... and then cloned into pENTR/D/SD entry vector using the In-Fusion cloning kit (Takara). Inserts of all plasmids were sequenced by Macrogen ...
-
bioRxiv - Immunology 2023Quote: The medium from transfected HEK293T cells was replaced with Opti-MEM containing 1 μM of B/B Homodimeriser (AP20187; Clontech) and incubated for 30 min ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 500 nM of the B/B dimerizer (TaKaRa 635058) was added 2 hours before the start of the assay (or an Ethanol vehicle control was added) ...
-
bioRxiv - Immunology 2019Quote: ... B/B Homodimerizer (Takara, 635059, equivalent to AP-20187), disuccinimidyl suberate (DSS ...
-
bioRxiv - Neuroscience 2022Quote: ... AP20187 (B/B) (Clontech, Saint-Germain-en-Laye France) was added 4 h post-transfection overnight.
-
bioRxiv - Cancer Biology 2021Quote: ... DAPI stained nuclei were diluted to a concentration of 60,000 cell/mL in 1x PBS + 1% BSA + 1x Second Diluent + 0.2U SUPERase·In RNase Inhibitor and dispensed onto the ICELL8 3 ‘DE Chip (Takara Bio, Cat# 640143) using the ICELL8 MultiSample NanoDispenser ...
-
bioRxiv - Genomics 2020Quote: ... The cDNA synthesis was carried out by using 5 g of total RNA or 1 g of PAPed RNA with RT primer (5-TTTTTTTTUUUTTTTTVN-3) by PrimeScript II Reverse Transcriptase (TaKaRa Bio). The full-length cDNAs were selected by Cap Trapper method 60 ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by an incubation overnight at 4°C with antiDsRed rabbit polyclonal primary antibody (1:1000, 632496 Takara Bio) diluted in a triton buffer (0.3% Triton X-100 diluted in PBS-DEPC) ...
-
bioRxiv - Biophysics 2021Quote: ... The resulting supernatant was collected by ultracentrifugation (150,000 × g, 1 hour, 4 °C) and applied onto an immobilized metal-ion affinity chromatography column (Talon, Clontech) equilibrated with 40 mM Tris ...
-
bioRxiv - Immunology 2020Quote: ... non-tissue culture treated 96-well plates were coated overnight at 4 °C with 1 ml of retronectin (Takara) at 25μg/ml in PBS ...
-
bioRxiv - Developmental Biology 2023Quote: ... They were then incubated O/N at 4°C with the corresponding primary antibody: anti-DsRed (1:500; Clontech), mouse anti-GFP ([1:100] ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Microbiology 2022Quote: ... expression was induced by addition of 4 ng/ml anhydrotetracycline (Clontech) at 4 hpi.
-
bioRxiv - Microbiology 2021Quote: ... 4 μl of 5X In-Fusion premix (Takara Bio, cat#638909), and milliQ water up to 20 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using 4 µL TransIT 293 (Takara, Shiga, Japan) and 100 µL OPTI-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... and human adult heart RNA (n=4 pooled, Cat #636583, Takara) were used for bulk RNA sequencing ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1.0 μl of 25mM B/B (in DMSO) (AP20187, Takara) was added to 50ul of PGCs (3,000 PGCs/μl ...