Labshake search
Citations for Takara Bio :
51 - 100 of 575 citations for 7 nitro 9H fluorene 2 sulfonic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...
-
bioRxiv - Cell Biology 2021Quote: ... containing doxycycline (2 mg/ml, Clontech). We kept the cells in this medium for 5 days ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 Units of Exonuclease III (Takara) were added to 1ug of NCPs in ExoIII digestion buffer (50 mM Tris– HCl (pH 8.0) ...
-
bioRxiv - Bioengineering 2023Quote: ... 2 µg pantropic pVSV-G (Clontech), 3 µg pCL- (Imgenex) ...
-
bioRxiv - Immunology 2023Quote: ... 2 µL 100 µM DTT (Takara), 2 µL 10 µM template switching oligo ...
-
bioRxiv - Immunology 2023Quote: ... version 2 (Takara cat. no. 634411) and mRRBS library preparation was performed using custom procedures previously described by our group (23 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and 2 U recombinant inhibitor (TaKaRa) for samples containing biological inhibitor ...
-
bioRxiv - Microbiology 2021Quote: ... HEK293 cells were cotransfected with the expression plasmids for D614G S or D614G/P681R (400 ng) with pDSP1-7 (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). To prepare target cells ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Neurons were transfected with GCaMP6 or NEMO-encoding plasmids at 7 to 9 days after plating using a calcium phosphate transfection kit (Takara Bio Inc).
-
bioRxiv - Neuroscience 2020Quote: ... 2 μL of the RT reaction was combined with 2.5 μL of 10X Advantage 2 buffer (Takara), 2.5 μL of 2.5 mM dNTPs (Takara) ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2020Quote: ... Protein concentrations of cell lysates were measured using a bicinchoninic acid protein assay kit (Takara Bio Inc.). Cell lysate containing the same amount of protein was mixed with 10 volumes of methanol and then centrifuged at 20,000 × g for 30 min to precipitate proteins ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fractions were precipitated with trichloroacetic acid (TCA) and subjected to Western blot analysis (anti-His antibody, Clontech). Additionally ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Immunology 2022Quote: ... After the optimization of PCR cycle number using SYBER Green I Nucleic Acid gel Stain (Takara Bio), transposed fragments were amplified using NEBNext High Fidelity 2× PCR Master mix and index primers ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Bioengineering 2019Quote: The OVCAR-8 and MCF-7 cell lines were stably transfected using expression vectors encoding the fluorescent protein DsRed2 from Clontech (Mountain View, CA) according to previously reported protocols (Brimacombe et al. ...
-
Changes in cell morphology and function induced by NRAS Q61R mutation in lymphatic endothelial cellsbioRxiv - Cell Biology 2023Quote: ... The pLVSIN-EF1α-AcGFP-C1 vector (5.5 μg) was added to 7 μL Lentiviral Mix High Titer Packaging Mix (Takara Bio Inc., Otsu, Japan), 1500 μL serum-free DMEM ...
-
bioRxiv - Physiology 2024Quote: Flies treated with the same procedure as the lifespan assay were collected after 7-day EF/Sham exposure and homogenized in RNAiso reagent (Takara Bio, Shiga, Japan). Ten to twenty flies were homogenized in one tube ...
-
bioRxiv - Plant Biology 2020Quote: ... and 2 µg cDNA (Takara, Clonetech, USA) was prepared as per the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 × 106 Lenti-X 293T cells (Clontech) were seeded in 6-well plates in 1.5 ml DMEM (Life Technologies ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Neuroscience 2019Quote: ... 2 U/μl RNase Inhibitor (Clontech/TaKaRa). We generated single cell RNA-Seq libraries using a modified Smart-seq2 method (Ding et al. ...
-
bioRxiv - Developmental Biology 2019Quote: ... The Advantage GC 2 PCR Kit (Takara) was used for gene cloning ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech). Complementary 60 bp-ends to the target sequence on M ...
-
bioRxiv - Bioengineering 2019Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Microbiology 2020Quote: ... or Advantage 2 Polymerase mix (Takara Bio) for amplification of UTRs and Pfmyob ...
-
bioRxiv - Genomics 2019Quote: ... and an Advantage 2 PCR Kit (Clontech) were used for cDNA generation ...
-
bioRxiv - Zoology 2021Quote: ... combined with 2 × GC buffer (RR02AG, TaKara) were used for amplification ...
-
bioRxiv - Immunology 2020Quote: ... 25 μL 2×PrimeSTAR GC buffer (TaKaRa), 0.5 μL PrimeSTARWHS DNA polymerase (2.5 U/μL ...
-
bioRxiv - Microbiology 2023Quote: ... anti-E-cadherin (clone ECCD-2) (Takara), goat anti-rat488 (Thermo Fisher) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... using the Advantage 2 Polymerase kit (Clontech) and specific primers located on either side of the target locus ...
-
bioRxiv - Developmental Biology 2023Quote: ... Advantage 2 polymerase (TaKaRa Bio, Shiga, Japan), or Q5 Hi-Fidelity DNA Polymerase (New England Biolabs ...
-
bioRxiv - Immunology 2023Quote: ... and 2 µL Smartscribe Reverse Transcriptase (Takara). RNA mixtures were combined with the RT reaction mixture ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were FACS-sorted on a Becton Dickinson FACS Aria cell sorter gating for DAPI−/DRAQ5+/GFP+ cells directly collected in 100 μl of RA1 lysis buffer with 2 μl tris(2-carboxyethyl)phosphine (TCEP) from NucleoSpin RNA XS kit (Clontech).
-
bioRxiv - Plant Biology 2021Quote: ... and HBS1-R (BamHI)] and HBS1 [using primers HBS1-2-F (NdeI) and HBS1-2-R (BamHI)] were amplified and subcloned into pGADT7 vectors (Clontech). Bait and prey plasmids were co-transformed into the yeast strain AH109 according to the manufacture’s introduction (Clontech) ...
-
bioRxiv - Microbiology 2023Quote: ... The nine fragments of SARS-CoV-2 and the UTR linker for SARS-CoV-2 were prepared by PCR using PrimeSTAR GXL DNA polymerase (Takara). After gel purification of the fragments ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Full-length β-catenin and a C-terminal deletion of tle3b (NM_131780, complete reading frame after amino acid 210) were cloned in pGAD (Clontech). Combinations of plasmids to test two-hybrid interactions were co-transformed in Y2Gold yeast strain (Suppl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Cancer Biology 2023Quote: ... sublines 14D7 and 24C7.8 The presence of the deletion on the translocated and the wildtype allele was validated by PCR using the Terra PCR Direct Polymerase Mix (Takara Bio Europe; supplemental Table 7). From line 14D7 ...