Labshake search
Citations for Takara Bio :
501 - 550 of 2300 citations for 7 bromo 1 2 3 4 tetrahydroisoquinoline 1 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 1 μM rapamycin analog AP21967 (AP, Takara 635056) was added ∼ 18 hr post-transfection to treat the cells for 6 – 10 hr to induce coaggregation.
-
bioRxiv - Neuroscience 2024Quote: ... and rabbit-anti-DsRed (1:1000, Takara, 632496). After 3 washes in PBS ...
-
bioRxiv - Cell Biology 2024Quote: ... 0.5U µl-1 RNase Inhibitor (Takara Bio, #2313B), 2.0µM Template Switching Oligo (TSO ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 volume of Lenti-X concentrator (Clontech, 631231) was added to 3 volumes of clarified-lentivirus containing medium ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-ctcgagtgcggccgcaagcttgctcatgacgctgccacggtg-3’ using PrimeSTAR HS (Takara). The pET28a was digested at NdeI and HindIII sites ...
-
Expansion of gamma-butyrolactone signaling molecule biosynthesis to phosphotriester natural productsbioRxiv - Biochemistry 2020Quote: ... 5’-cagtggtggtggtggtggtgctcgagtcaacacctggcgttgaccg-3’ using PrimeSTAR HS (Takara). The pET28a-MBP was digested at BamH1 and XhoI sites ...
-
bioRxiv - Microbiology 2022Quote: ... cerevisiae strain AH109 (Matchmaker 3 system, Clontech) was used ...
-
bioRxiv - Immunology 2022Quote: ... the SMARTer RACE 5’/3’ Kit (Takara) was used following manufacturer’s protocol and using the following primer ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... the 3’-Full RACE Core Set (TaKaRa) was used to extend Rtl6 mRNA from the mouse brain at 8 weeks of age according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... a SMARTer RACE 5’/3’kit (Takara) was used ...
-
bioRxiv - Developmental Biology 2023Quote: SMARTer RACE 5’/3’ Kit from Takara Bio was used following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... and incubated with a mix of up to three primary antibodies simultaneously diluted in PBST with 1 % NDS overnight at room temperature with the following primary antibodies: rabbit anti-dsRed (1:1000; Clontech, AB_10013483), chicken anti-GFP (1:1000 ...
-
bioRxiv - Neuroscience 2019Quote: ... and then incubated with a GFP antiserum (rabbit, 1:1000, Life Technology, #A6455) or an mCherry antiserum (mouse, 1:1000, Clontech, #632543). Primary antisera were diluted in PBS with 2% NGS overnight at 4°C ...
-
Mis6/CENP-I maintains CENP-A nucleosomes against centromeric non-coding transcription during mitosisbioRxiv - Cell Biology 2021Quote: ... the rabbit anti-RNA polymerase II (phosphoS5) polyclonal antibody (1:100; ab5131) or rabbit anti-GFP polyclonal antibody (1:250; Clontech, 632592) was incubated with 200 µL of the lysate for 1 h at 4°C ...
-
bioRxiv - Plant Biology 2021Quote: ... qRT-PCR was performed on 1 μL of 1 in 40 diluted cDNA in 15 μL reactions using SYBR Premix Ex-Taq II reagent (Takara Bio) in a Bio-Rad CFX96 real-time system (see Table S1 for primer pairs) ...
-
bioRxiv - Genetics 2020Quote: ... Membranes were blocked in 5% milk for 1 h at room temperature and then probed with mouse-anti-EGFP (for pYFP constructs; 1:8000; Clontech, 632380) or mouse-anti-V5 tag (1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... They were then incubated overnight at 4°C with the following primary antibodies diluted in PBS - 0.3% Triton X100 - 1% NGS: rabbit anti-ZsGreen (1/1000, Clontech, 632474, RRID:AB_2491179) or rabbit anti- DCX (1/2000 ...
-
bioRxiv - Developmental Biology 2023Quote: ... The following antibodies were used: rabbit or rat anti-dsRed (1:200, Clontech 632496 or 5F8 1:400, Chromotek 5f8-100); chicken anti-GFP (1:800 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 50 mM maleic acid buffer pH 5.5) containing 100 mg Yatalase (Takara) and 100 mg Lysing Enzymes from Trichoderma harzianum (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 (Takara, #6045) according to manufacturer’s protocols ...
-
bioRxiv - Immunology 2022Quote: ... version 2 (Takara). Fastq files were generated from bcl files using BCL2FASTQ v2.17.1.14 with default parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 (Takara Bio).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (Takara Bio).
-
bioRxiv - Evolutionary Biology 2021Quote: The 5’ and 3’ ends of Cpun_dsx were amplified using the SMARTer RACE 5’/3’kit (TaKaRa, Shiga, Japan) and gene-specific primers designed for OD2 (“Cpun_dsx OD2 5’RACE” and “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Cell Biology 2021Quote: ... The HBV core protein coding region was amplified using the forward primer 5’-ATCATAAGCTTACCATGGACATCGACCCTTATAAAG-3’ and reverse primer 5’-TAGATGGTACCCTAACATTGAGGTTCCCGAG-3’ and subcloned into the pcDNA3.1 vector (Clontech) via HindIII and KpnI restriction sites ...
-
bioRxiv - Cell Biology 2019Quote: ... a pFA6a-3’UTR-AfeI-5’UTR-scd2-kanMX-3’UTR (pSM2255) plasmid was generated by InFusion cloning (Clontech) of a pFA6a-based plasmid containing the yeast kanMX resistance cassette digested with KpnI and AscI ...
-
bioRxiv - Plant Biology 2022Quote: CRISIS2 or Nb14-3-3 was fused with the Gal4 DNA binding domain in pGBKT7 (Clontech, PT3248-5, USA) and inserted into the Saccharomyces cerevisiae Y2HGold strain (Clontech ...
-
bioRxiv - Cancer Biology 2022Quote: ... using 5′-GGGTTAGGGATAGGCTTAC-CACCGGTTTACTTGTACAGCTCGTCCATGC -3′ and 5′-CTTGTACAAAGTGGTTACCGGAGGATC-CGGTGGTGTGAGCAAGGGCGAGGAGCTG -3′ primers for PCR and In-Fusion Cloning (Takara Bio). The pStrep-ANKLE1 plasmid was obtained by cloning annealed oligonucleotides containing Twin-Strep-tag (5′ CCGGTCACCATGGCGTGGAGCCACCCGCAGTT-CGAGAAAGGTGGAGGTTCCGGAGGTGGATCGG-GAGGTTCGGCGTGGAGCCACCCGC-AGTTCGAAAAAGC 3′ and 5′ GGCCGCTTTTTCGAACTGC-GGGTGGCTCCACGCCGAACCTCCCGAT-CCACCTCCGGAACCTCCACCTTTCTCGAA-CTGCGGGTGGCTCCACGCCATGGTGA 3′ ...
-
bioRxiv - Immunology 2021Quote: ... A2058 and MDST8 as previously described (7) with small changes for adherent cell lines omitting RetroNectin (Clontech). LCL-1 was transduced with single minigenes ...
-
bioRxiv - Neuroscience 2023Quote: Neurons were transfected at day in vitro (DIV) 7 using CalPhos Mammalian Transfection Kit (Takara Bio, 631312). Transfection solution was prepared by adding 1.5 µg DNA per construct (3 µg in total ...
-
bioRxiv - Neuroscience 2020Quote: ... 4 U RNAse inhibitor (Takara, 2313A), 10mM dNTPs (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2019Quote: To quantify EEC morphology score, chick anti-GFP (Aves GFP1010, 1:500 dilution) and rabbit anti-mcherry (TAKARA 632496, 1:250 dilution) antibodies were used in the fixed Tg(gata5:lifActin-EGFP);Tg(neurod1:TagRFP ...
-
bioRxiv - Cell Biology 2022Quote: ... followed by SDS–PAGE and immunoblotting with goat anti-GST (1:3000, Cytiva, 27-4577-01) and mouse anti-6xHis (1:3000, Takara Bio, 631212) antibodies ...
-
bioRxiv - Physiology 2022Quote: ... Cleared lysates were loaded into wells of the SDS-agarose gels (1% SeaKem Gold Agarose [Lonza, Basel, Switzerland], 30% glycerol, and 1 × Tris/glycine/SDS [TG-SDS] buffer [Takara Bio Inc.]) and then electrophoresed in a running buffer (1 × TG-SDS buffer and 10 mM 2-mercaptoethanol ...
-
bioRxiv - Cell Biology 2020Quote: The full-sized Not (aa 496) was PCR-amplified using primers 5’-ttgaattcatgtccgagacgggttgtc-3’ and 5’-ttgtcgacttactcgtattccagcacatt-3’ and subcloned into pGBT9 vector (Clontech) in frame with DNA-binding domain of GAL4 using restriction sites EcoRI and Sal1.
-
bioRxiv - Cell Biology 2020Quote: The full-sized CP190 (aa 1096) was PCR-amplified using primers 5’-ttcccgggcatgggtgaagtcaagtccg-3’ and 5’-tttggaggagctatatttactaagatct-3’ and subcloned into pGAD424 vector (Clontech) in frame with activation domain of GAL4 using restriction sites SmaI and BamHI ...
-
bioRxiv - Genomics 2020Quote: ... 10 μL of which was subject to PCR with primer pair 5′- AATGATACGGCGACCACCGAGATCT-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ and 5′-CAAGCAGAAGACGGCATACGAGAT-CTGATC-TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-GCTGCGCTCGATGCAAAATA-3′ using PrimeSTAR Max PCR master mix (R045A, Takara) to add sequencing adapter sequences to CASB barcode.
-
bioRxiv - Molecular Biology 2019Quote: The SINV-GFP-mut plasmid was generated by site directed mutagenesis using forward (5’ CGCATTTATCAGGACATCAGATGCACCACTGGTCTCA 3’) and reverse (5’ ATGTCCTGATAAATGCGGCGTTCGGGATGTCAATAGA 3’) primers and the In-Fusion HD Cloning Kit (Takara) following the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2020Quote: ... mCherry cDNA was amplified using primers NheI mCherry Fw (5’-acgctagctatggtgagcaagggcgaggag-3’) and XhoI mCherry Rv (5’-gactcgagttacttgtacagctcgtccat-3’) from mCherry Vector (Clontech), and then the product was introduced into NheI-XhoI sites of the pFRT-SV40-FRT vector (Gift from Elizabeth R ...
-
Potential for virus endogenization in humans through testicular germ cell infection: the case of HIVbioRxiv - Microbiology 2020Quote: ... VSV G-pseudotyped HIV-1 using full-length HIV-1 molecular clone pNL4-3 [79] or the R5-tropic pNL4-3 AD8 derivative [80] and VSV-G envelope encoding plasmid (PT3343-5, Clontech); 4 ...
-
bioRxiv - Cell Biology 2021Quote: ... PCR amplification was carried out with primers (Forward: 5’-AGGCAGTGAGTGAAGTGT -3’, Reverse: 5’-TAAGTTGGCGAGGCTTGA -3’) using PrimeSTAR HS DNA Polymerase (DR010A, Takara) under the following conditions ...
-
bioRxiv - Biophysics 2022Quote: ... 5’ and 3’-RACE-Ready cDNA templates were synthesized using a SMARTer® RACE 5’/3’ Kit (Takara Bio, USA) and subsequently used to amplify 5’ and 3’ end sequences of P ...
-
bioRxiv - Molecular Biology 2020Quote: ... The FOXR1 wild-type and M280L mutant were then PCR amplified using forward 5′-AAAGCACTCGAGATGGGGAACGAGCTCTTTCTG-3’andreverse5’-TTTGGCCCGCGGTTAAAGATCAAAGAGGAAGGG-3’ primers and subcloned into the XhoI and SacII restriction sites of pEGFP-C3 (Clontech) to create an N-terminal EGFP tag ...
-
bioRxiv - Cell Biology 2020Quote: ... with 5’-cgGAATTCaccATGgagcagaagctc atctcagaagaagacctcggtAAGGATAACACCGTGCC-3’ and 5’-ataagaatGCGGCCGCtaaact ATTATTTTTCTGCACTACGCAGG-3’ followed by cloning into the EcoRI and Not I sites of pIRESpuro3 (Clontech) creating pIRESpuro3-myc-BirA ...
-
bioRxiv - Molecular Biology 2020Quote: ... containing the 5’ end was used and the 3’ of TciALDO cDNA was obtained by 3’ RACE (SMARTer RACE cDNA Amplification Kit, Clontech) using T ...
-
bioRxiv - Neuroscience 2021Quote: ... the promoter pgrd-10 was amplified from fosmid WRM0612bC07 using 5’-ccatgattacgccaatcgtcatc-3’ and 5’-tggccaatcccggggtttttaga-3’ and cloned with Gateway backbone amplified using 5’-ccccgggattggcca-3’ and 5’-ttggcgtaatcatgg-3’ to make pgrd-10∷GW [pNBRGWY151] using infusion cloning(Takara). It was then recombined with ced-10 WT[pNBRGWY88] using LR recombination (Invitrogen).
-
bioRxiv - Molecular Biology 2023Quote: ... and those targeting the Alu repeat sequence in the nuclear genome (5′-CTTGCAGTGAGCCGAGATT-3′ and 5′- GAGACGGAGTCTCGCTCTGTC-3′) (75) with TB Green Premix Ex Taq II (TaKaRa) on Thermal Cycler Dice Real Time System II (TaKaRa) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We amplified a 1.4 kb genomic fragment with PCR primers AIP3F (5’- GGCGCTATACCCGCTCGTGTCC-3’) and AIP5R2 (5’-CTTCATATTTGAAGACGAGGGAGG-3’) using 10 ng genomic DNA and Advantage DNA polymerase (Clontech) with the following cycling conditions ...
-
bioRxiv - Molecular Biology 2023Quote: ... the 3’ UTR of the virus were determined using the SMARTer®RACE 5’/3’ Kit (Takara Bio, Kusatsu, Japan). 2.4 µg of RGMoV gRNA was polyadenylated using Poly(A)polymerase (600 u/µl ...