Labshake search
Citations for Takara Bio :
251 - 300 of 1818 citations for 7 Chloro 3 4 dihydro 1 2H isoquinolinone since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2023Quote: ... 5′-Cy5 and 3′-Cy3 labeled ITS2 RNA was synthesized from Takara Biomedical Technology ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Immunology 2019Quote: ... RAC2 mutant 3’UTR constructs were generated using Infusion HD cloning kit (Clontech) with the following primers ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Neuroscience 2020Quote: ... Transfection was performed at DIV 3 using CalPhos Mammalian Transfection Kit (TakaRa/Clontech). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Cell Biology 2020Quote: ... After 24 h cells were transfected with an eGFP vector (3 μg; Clontech) using Fugene-6 HD reagent according to the manufacturer's protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... 3′ RACE-PCR was performed using the SMARTer PCR cDNA synthesis kit (Clontech) following the instructions supplied by the manufacturer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 5′ RACE was performed using the SMARTer RACE 5/3 kit (Takara Bio) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2019Quote: ... Yeast-two-hybrid analysis was performed according to the Matchmaker 3 manual (Clontech). S ...
-
bioRxiv - Molecular Biology 2022Quote: ... mEGFP and 3’UTR fragments were amplified by PrimeSTAR Max DNA polymerase (Takara). The replication origin and selection marker were derived from a mammalian expression vector ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: Target RNA was labeled at the 3′ end using Poly(A) Polymerase (Takara) and [32P]cordycepin-5′-triphosphate ...
-
bioRxiv - Microbiology 2022Quote: ... expression was induced by addition of 4 ng/ml anhydrotetracycline (Clontech) at 4 hpi.
-
bioRxiv - Microbiology 2021Quote: ... 4 μl of 5X In-Fusion premix (Takara Bio, cat#638909), and milliQ water up to 20 μl ...
-
bioRxiv - Microbiology 2024Quote: ... Transfection was performed using 4 µL TransIT 293 (Takara, Shiga, Japan) and 100 µL OPTI-MEM (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2024Quote: ... and human adult heart RNA (n=4 pooled, Cat #636583, Takara) were used for bulk RNA sequencing ...
-
bioRxiv - Cancer Biology 2023Quote: ... sublines 14D7 and 24C7.8 The presence of the deletion on the translocated and the wildtype allele was validated by PCR using the Terra PCR Direct Polymerase Mix (Takara Bio Europe; supplemental Table 7). From line 14D7 ...
-
bioRxiv - Genomics 2019Quote: ... the beads were washed twice with 50 μl 80% freshly-prepared EtOH on the magnetic stand and the dried beads pellets were resuspended in 4 μL elution buffer (RNAse inhibitor 1/200 Takara, CDS primer 0.5 μL in RNAse free water) immediately followed by an incubation at 72°C for 3 min ...
-
bioRxiv - Biochemistry 2022Quote: ... The dialyzed fraction was mixed for 3 h with Talon Metal Affinity Resin (Clontech) that had been equilibrated with Buffer T ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA fragments larger than 3 kb were amplified with PrimeSTAR Max (Clontech Laboratories, Inc.); all other PCR products were amplified with PrimeSTAR HS DNA polymerase (Clontech Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... 9.0 μL of 3 SMART™ CDS Primer II A (12 M, Clontech, 634936), and 1.4 μL of Loading Reagent (20X ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids were co-transformed pairwise into AH109 yeast strains (Matchmaker 3 System, Clontech), and selected initially on double drop-out (DDO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 14-3-3γ CDS was amplified by PCR and subcloned into pCMV-mCherry (Clontech). Deletion and point mutations of SMAUG1 were created using Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assays were performed with the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio). Saccharomyces cerevisiae strain AH109 was co-transformed with different pairs of pGADT7 and pGBKT7 harboring IREH1 or B1-Rafs ...
-
bioRxiv - Cell Biology 2019Quote: ... and 4 μg of pCMV-β-galactosidase (Clontech Laboratories, Inc., CA, USA) using electroporation according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... 4 μl of 2.5 mM of each deoxyribose triphosphates (dNTPs) (TAKARA, Japan), and 1 μl of 10 mM of primers or TaqMan probes.
-
bioRxiv - Microbiology 2021Quote: ... UK) containing the 27F/1492R primer set and MightyAmp DNA polymerase Ver.3 (Takara Bio). PCR was performed according to a previous report (Fujiyoshi et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... To ensure we had the full-length transcript we performed 3’RACE (SMARTer RACE Takara) using a forward primer 5’-GGAGCACAGACCAATGGAGC-3’.
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants was used for 5’ RACE with SMARTer RACE 5’/3’ Kit (Takara, Japan) according to the manual booklet.
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the SMARTer ICELL8 3 ‘DE Reagent Kit V2 (Takara Bio, Cat # 640167) from isolated nuclei ...
-
bioRxiv - Microbiology 2022Quote: ... the 5′-terminus of the viral genome was determined by 5′/3′ RACE kits (TaKaRa). The resulting whole genome sequence of the GX_P2V variant was deposited in GenBank (accession number MW532698) ...
-
bioRxiv - Cell Biology 2022Quote: Yeast-two-hybrid analysis was performed with the MATCHMAKER GAL4 Two-Hybrid System 3 (Clontech) essentially as described (39) ...
-
bioRxiv - Microbiology 2020Quote: The putative 3’ UTR of FOXO3a was cloned into the dual luciferase reporter pSiCheck2 (Clontech) using the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... mouse DPPA3 cDNA was sub-cloned into a pGEX4T-3 plasmid using In-Fusion (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: RNA-seq libraries for gene expression were constructed using Clontech SMARTer v.3 kit (Takara). Small RNA libraries were constructed using NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... to the 3’ end of the GFP at the PmeI site using InFusion Cloning (TaKaRa) and screened with PCR and restriction digests (Supplementary Table S8) ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μl of cold Poly-A-tailing master mix (3.3x Smartscribe first strand buffer (Takara), 0.16 U/μl Poly-A-polymerase (2180A ...
-
bioRxiv - Cancer Biology 2023Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 °C for 45 min and the supernatants incubated with TALON beads (Clontech) pre-equlibrated with purification buffer at RT over night with overhead rotation followed by washing with wash buffer (8M urea ...