Labshake search
Citations for Takara Bio :
151 - 200 of 2533 citations for 7 Chloro 1 3 dihydro 5 phenyl 2H 1 4 benzodiazepin 2 thione since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2022Quote: ... Lentiviral transduction of murine alveolar macrophages was performed for 7 days in the presence of 5 μg/cm2 RetroNectin (Takara). Stable gene expression was confirmed by GFP signals using a BZ-X710 (KEYENCE ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... The 5’ RACE reaction was performed with an ac13-specific primer (ac13-GSP1) using a SMARTer® RACE 5’/3’ Kit (TaKaRa) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2023Quote: Complete cDNA sequences of taste receptors were obtained using a SMARTer 5’/3’ kit for RACE PCR to obtain 5’ sequence information missing from reference transcriptome (Takara, #634858). Briefly ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Synthetic Biology 2022Quote: Retroviral/lentiviral transductions were performed on days 3 and 4 post activation on retronectin (Takara) coated non-tissue culture treated plates ...
-
bioRxiv - Bioengineering 2022Quote: ... 1 µl purified cDNA was amplified with an Advantage HF 2 PCR kit (Takara) in a 25 µl reaction containing 0.5 µl forward primer (10 µM ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we made a master mix using the primers 2550F = 5’-GTT ACT GAT TCG TCT ACG AGA-3’ and 2718R = 5’-ATT GAA ATG ATC CAG TGC TTG-3’ and TaKaRa ExTaq DNA Polymerase (Takara Bio USA, Inc). We ran the samples for 31 cycles and ran the PCR product on a 2% agarose gel.
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Cancer Biology 2022Quote: ... filtered through 0.45 μm syringe filters (Starlab) and concentrated using 1/3 volume of Lenti-X concentrator (Clontech) as per the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: Transcription start sites were characterised by cloning and sequencing 5’ RACE products using the SMARTer RACE 5’/3’ kit (Takara Bio USA, Inc). In summary ...
-
bioRxiv - Genomics 2019Quote: ... We mixed 2 µg of total RNA with 1 µl 10 mM dNTPs (Clontech #639125) and 1 µl of 50 µM SMART_dT18VN primer (for a complete list of primer sequences ...
-
bioRxiv - Plant Biology 2023Quote: ... 1 μg total RNA was reverse transcribed into cDNA with the SMARTer RACE 5’ Kit (Clontech). PCR was performed using primer GSP-HO1 and the Universal Primer Mix (UPM ...
-
bioRxiv - Developmental Biology 2020Quote: ... embryos were incubated overnight at 4°C with rabbit anti-DsRed (1:500 in BB; Clontech 101004), mouse anti-Myh6 antibody (1:200 in BB ...
-
bioRxiv - Neuroscience 2019Quote: ... Sections were incubated overnight at 4° C with anti-rabbit tdTomato (1:2000; TaKaRa, Cat# 632543, RRID:AB_2307319), anti-rabbit GFP (1:2000 ...
-
bioRxiv - Cell Biology 2022Quote: ... The extract was incubated for 1 h at 4 °C with Talon resin (Clontech, Mountain View, CA), loaded onto a column ...
-
bioRxiv - Plant Biology 2020Quote: ... 5’ and 3’ RACE (rapid amplification of cDNA ends) were performed using the manufacturer’s instructions (Clontech).
-
bioRxiv - Immunology 2019Quote: ... RACE-ready cDNA synthesis was performed using the SMARTer RACE 5’/3’ Kit (Takara Bio USA) using primers with specificity to IgM ...
-
bioRxiv - Microbiology 2021Quote: ... 5 pmol of probe and 10 μl of Premix Ex Taq (2×) (Takara). Positive amplification controls were DNA purified from ASFV virions at different concentrations used as standards ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μL of 2× SYBR Premix Ex Taq II (TaKaRa, Beijing, China), 1 μL of cDNA ...
-
bioRxiv - Microbiology 2021Quote: The LTR promoter of the HIV-1 laboratory strain pNL4-3 was cloned into the pTA-Luc backbone (Clontech) and is henceforth referred to as pTA-Luc-NL4-3 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 4 μl of Ligation Mix (5 mM ATP, 7U Terminal Deoxynucleotidyl Transferase (TdT) (2230B, Takara), 15 U T4 RNA Ligase High Concentration (M0437 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... with 0.1 µL of Taq Polymerase 5 U.µL-1 (TaKaRa Ex Taq® Kit MgCl2 Free Buffer) (TaKaRa Ex Taq ...
-
bioRxiv - Cancer Biology 2023Quote: ... RT-PCR was performed using diluted cDNA (1:5 in water) and PrimeStar DNA Polymerase (Takara, R010A) with primers and PCR conditions listed in Table 1 ...
-
bioRxiv - Cell Biology 2019Quote: ... 1 mM MgCl2 and 2 μl of CIAP (Calf intestine AP, 30 U/μl: Takara#2250A). For the Endo H reactions ...
-
bioRxiv - Plant Biology 2022Quote: ... bHLH39-1 and bHLH39-2 fused to the BD were co-transformed into yeast Y2HGold (Clontech). Transformants were grown on SD-Leu-Trp plates ...
-
bioRxiv - Plant Biology 2023Quote: ... and gametandiopore of one-month-old Tak-1 and Tak-2 by NucleoSpin RNA Plant (Takara) or Monarch Total RNA Miniprep Kit (New England BioLabs ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were stained with anti-mouse E-cadherin monoclonal antibody ECCD-2 (1:100, Takara) for 16 h at 4°C ...
-
bioRxiv - Cancer Biology 2021Quote: ... at a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Cancer Biology 2023Quote: ... in a molar ratio of 2:1:1 and transfected into the Lenti-X™ 293T packaging cell line (632180, TaKaRa Bio Inc., Kusatsu, Shiga, Japan) using Xfect™ Transfection Reagent (631317 ...
-
bioRxiv - Plant Biology 2020Quote: ... which contained 4 µL of lysis buffer with 1 U/µL of Recombinant RNase Inhibitor (RRI, Clontech 2313B), 0.1% [w/v] Triton X-100 (Thermo Scientific 85111) ...
-
bioRxiv - Cell Biology 2019Quote: ... with prefilled wells of 4 µl lysis solution with 1 U/µl of recombinant RNase inhibitor (Clontech #2313B), 0.1% Triton X-100 (Thermo #85111) ...
-
bioRxiv - Immunology 2023Quote: Non-tissue culture treated 12-well plates were coated overnight at 4°C with 1 ml Retronectin (Takara) at 25 μg/ml in PBS ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Genetics 2022Quote: ... 1 μgml−1 doxcycline (TAKARA Bio) and 10−6 M dexamethasone (Sigma Aldrich).
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µM Shield-1 (Takara # 632189) for 4 hours ...
-
bioRxiv - Bioengineering 2021Quote: ... 7 μL RNase-free water (Takara, Japan), and 10 μL iQ SYBR Green Supermix (Bio-Rad ...