Labshake search
Citations for Takara Bio :
101 - 150 of 1044 citations for 7 CHLORO 10 11 DIHYDRO 5H DIBENZ B F ACEPIN 2 OL since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (ref.69) (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). On day 3 (24 hours post-transfection) ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293 cells were cotransfected with the S expression plasmids (400 ng) and pDSP8-11 (ref.59) (400 ng) using TransIT-LT1 (Takara, Cat# MIR2300). On day 3 (24 h posttransfection) ...
-
bioRxiv - Cell Biology 2023Quote: The pik1-11 temperature sensitive allele was constructed as described (Tang et al., 2019) with the exception that EX taq polymerase (Takara, cat# 4025) and accompanying dNTPs (Takara ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... human MSI1 cDNA was amplified with the primers of MSI1_BamHI-F and MSI1_stopdead_XbaI-R (Table S6) using the PrimeScriptTM 1st strand cDNA Synthesis (Takara, 6210A) and PrimeSTAR ® Max DNA Polymerase kits according to manufacturer instructions (Takara ...
-
bioRxiv - Genetics 2020Quote: The final stitching PCR was performed using primers csrL-f and csrR-r with LA Taq polymerase (Takara) in a 50 μl reaction ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-PCR products of stage 2 ray florets using c25599_g2_i1 Fill-F and c25599_g2_i1 Fill-R primers (Table S2) were digested with SacI (Takara Bio Inc). Reaction mixture was consisted of 2.5 µL of PCR product ...
-
bioRxiv - Molecular Biology 2022Quote: ... and amplified by PCR using a forward primer containing a T7 promoter sequence (Supplemental Table 10) with the Advantage HF 2 kit (Takara Bio 639124) and the following cycling conditions ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Cancer Biology 2021Quote: ... Virus transduction was performed using RetroNectin® Recombinant Human Fibronectin Fragment (Takara, cat.no. T100A/B) according to the manufacturer’s instructions (with centrifugation) ...
-
bioRxiv - Biophysics 2022Quote: ... This plasmid expresses the PR isoform-B under a tetracycline controllable promoter (TetOff system, Clontech). To perform the SPT experiments ...
-
bioRxiv - Cancer Biology 2023Quote: ... mRNA was utilized with the SMARTer Human TCR a/b Profiling Kit v2 (Takara, USA). The resulting libraries were sequenced for paired-end reads of 2×250 bp on an Illumina system at a sequencing depth of 7.5X.
-
bioRxiv - Genetics 2019Quote: ... RNA was reverse transcribed using SMART-Seq Reverse Transcriptase followed by 11 cycles of PCR amplification (SMART-Seq v4 kit, Takara Bioscience, Cat. 634890). Purification and size selection of DNA was carried out using Ampure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2021Quote: ... plasmids respectively using primers HindIII_ZIKV_sfRNA and XbaI_GFP (Supplementary table 7) and PrimeSTAR GXL Polymerase (Takara, Japan). Cycling conditions were as follows ...
-
bioRxiv - Biophysics 2021Quote: ... The 7-kb band was excised and recycled using Agarose Gel DNA Extraction Kit (TaKaRa Bio). Concurrently ...
-
bioRxiv - Cell Biology 2022Quote: MCF-7 and T47D cells were harvested and total RNA was extracted with RNA Trizol (TAKARA) following the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2021Quote: ... IRES2-GFP cDNA was subcloned into pSIN lentiviral vector (kindly provided by F. Saudou) by using pIRES2-GFP (Clontech) as a template ...
-
bioRxiv - Microbiology 2023Quote: ... using Psme1Sal1-F/Psme1BamHI-R primer pairs (Table S4) and cloned as a Sal1/BamH1 fragment into pEGFPC1 (Clontech). For production of GST- and His6-Myc-fusion proteins ...
-
bioRxiv - Cell Biology 2024Quote: ... two PCRs were performed using li-Strep_ss-SBP-EGFP-Ecadherin (a gift plasmid from F. Perez) (Boncompain et al., 2012) and pEGFP-C1 (Clontech) as templates and the following primer pairs (GAT GCA CCC GGG AGG CGC GCC ATG and CTC CTC GCC CTT GCT CAC ACC TGC AGG TGG TTC ACG ...
-
bioRxiv - Genomics 2019Quote: ... 10 µl of 10 mM dNTPs (Clontech #639125), 2.5 µl RNase Inhibitor (Lucigen) ...
-
bioRxiv - Biochemistry 2021Quote: ... 10% glycerol) containing DNase I (10 U, Takara) and incubated at 37 °C for 1 hour ...
-
bioRxiv - Cancer Biology 2021Quote: ... and TCR beta chain libraries were generated using SMARTer Mouse TCR a/b Profiling Kit (Clontech). Samples were pooled to a final pool concentration of 4 nM and diluted to a final concentration of 13.5 pM ...
-
bioRxiv - Cell Biology 2021Quote: ... pBos-CENP-B-GFP was constructed by replacing the H2B fragment in pBos-H2B-GFP (Clontech) with the KpnI/BamHI-digested PCR fragments encoding the centromere-targeting domain (residues 1-163 ...
-
bioRxiv - Cancer Biology 2023Quote: PDGF-IRES-Cre was generated by cloning human PDGF-B and Cre into pQXIX vector (Clontech) as previously described5 ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 kit (Takara) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 (Takara, #6045) according to manufacturer’s protocols ...
-
bioRxiv - Immunology 2022Quote: ... version 2 (Takara). Fastq files were generated from bcl files using BCL2FASTQ v2.17.1.14 with default parameters ...
-
bioRxiv - Neuroscience 2022Quote: ... 2 (Takara Bio).
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (Takara Bio).
-
bioRxiv - Immunology 2021Quote: ... A2058 and MDST8 as previously described (7) with small changes for adherent cell lines omitting RetroNectin (Clontech). LCL-1 was transduced with single minigenes ...
-
bioRxiv - Neuroscience 2023Quote: Neurons were transfected at day in vitro (DIV) 7 using CalPhos Mammalian Transfection Kit (Takara Bio, 631312). Transfection solution was prepared by adding 1.5 µg DNA per construct (3 µg in total ...
-
bioRxiv - Cell Biology 2021Quote: ... pLL5.0-EGFP-HRasC20 was generated by insertion of EGFP-HRasC20 fragment which was amplified from pEGFP-F (#6074-1; Clontech) by PCR into pLL5.0 vector ...
-
bioRxiv - Plant Biology 2021Quote: ... The amplicons from SlACS2-prom1k-pPLV-F/R were cloned into pPLV451 using an In-Fusion HD Cloning kit (Clontech), to construct pACS2-GFPx3 and pACS2mut-GFPx3 ...
-
bioRxiv - Biochemistry 2021Quote: ... falciparum cDNA followed by Ligation Independent Cloning into HindIII/KpnI-cleaved plasmid pOPIN F (82) using the In-Fusion HD EcoDry Cloning Kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The EnvV2-Fca gene was amplified using primers Fe-gvm2Env-F and Fe-gvm2Env-R and detected using probe Fe-gvm2Env-P (containing 6-carboxy-fluorescein; FAM) (Takara). The internal control ...
-
bioRxiv - Immunology 2022Quote: ... Bulk TCR sequencing was performed using the SMARTer® Mouse TCR a/b Profiling Kit (Takara Bio). Libraries were sequenced using the 600-cycle MiSeq Reagent Kit v3 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Cell Biology 2021Quote: ... the coding sequences of human Pcnt B and Pcnt S were subcloned into peGFP-N1 (Takara Clontech) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs ...
-
bioRxiv - Biochemistry 2022Quote: shTnsB mutants (Fig. 7) were generated in the pHelper vector using the In-Fusion cloning kit from Takara and primers containing the desired point mutations ...
-
bioRxiv - Cell Biology 2024Quote: ... 7 μg of lentiviral vectors was mixed with a Lenti-X packaging (VSV-G) single shots tube (Clontech) in a final volume of 600 μl for 15 min before the transfection mix was added to subconfluent (80-90% ...
-
bioRxiv - Molecular Biology 2021Quote: ... A pair of gene specific primers TaAFR-F and TaAFR-R (S1 Table) and Tks Gflex™ DNA Polymerase (TaKaRa, Japan) were used to amplify the full-length coding sequences CDS amplified with Tks Gflex™ DNA Polymerase (TaKaRa ...
-
bioRxiv - Microbiology 2020Quote: ... the full-length cDNA of PacC amplified with primers PacC-F and PacC-R was digested with EcoRI and cloned into pGBKT7 (Clontech, USA) as pBD-PacC559 ...
-
bioRxiv - Plant Biology 2020Quote: ... was amplified with primer FvGID1a-P-KpnI-F and FvGID1a-P-SalI-R (TableS2) and ligated into pAbAi vector (Clontech Inc.) at KpnI and SalI sites ...
-
bioRxiv - Biochemistry 2021Quote: ... falciparum cDNA followed by Ligation Independent Cloning into HindIII/KpnI-cleaved plasmid pOPIN F (82) using the In-Fusion HD EcoDry Cloning Kit (Takara Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: Nanobody sequences were amplified by PCR with the specific primers (NbFt-F: gcaagatctgccaccatggcc CAGGTGCAGCTGCAGGAG; NbFt-R:gcaaagcttggatccAGCGTAATCTGGAACATCGTATGGGTA tgcggccgctgagga) and subcloned into the retroviral vector pMSCV (Clontech, Takara Bio, US). HEK-293T cells were grown in 10cm plates and cotransfected with plasmids expressing GFP-mFerritin and anti-ferritin nanobody clones using PEI (DNA:PEI=1:3) ...
-
bioRxiv - Developmental Biology 2019Quote: ... 2 mM dithiothreitol (Clontech), 2 μM template switching oligo (Exiqon) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 2 (Takara, Shiga, Japan) and 0.32 µM of each primer according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2021Quote: ... 10% FBS (Clontech), 50 U/mL penicillin ...
-
Human immunodeficiency virus-1 induces and targets host genomic R-loops for viral genome integrationbioRxiv - Molecular Biology 2024Quote: ... DNA was purified using the standard phenol-chloroform extract method and subjected to DNase I (Takara, 2270 B) treatment and reverse transcription for DRIPc-seq library construction ...