Labshake search
Citations for Takara Bio :
251 - 300 of 2609 citations for 7 Boc 3 chloro 5 6 7 8 tetrahydroimidazo 1 2 a pyrazine 2 carboxylic acid since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and 2 μg/ml Doxycycline (Clontech; Cat. No. 631311). iTF-iPSCs were counted and seeded onto double coated plates (Poly-D-Lysine-precoated Bio plates (Corning ...
-
bioRxiv - Neuroscience 2021Quote: ... and 2 ug/mL doxycycline (Clontech, Cat. No. 631311). i3Neurons were then fed three times a week by half media changes ...
-
bioRxiv - Neuroscience 2020Quote: ... containing 2 μL of 5X SMARTScribe RT buffer (Takara), 0.5 μL of 100 mM DTT (Millipore Sigma) ...
-
bioRxiv - Bioengineering 2019Quote: ... The PCR amplification used 2×PrimeSTAR Mix (Takara, Japan). The target dsDNA fragments for titration experiments were quantified using a PikoGreen dsDNA Quantitative Kit (Life iLab Biotech ...
-
bioRxiv - Zoology 2021Quote: ... 10 μL of 2×SYBR Green Premix (Takara, Japan), and 6.8 μL ddH2O ...
-
bioRxiv - Microbiology 2021Quote: ... followed by selection with 2 μg/ml puromycin (Clontech). (For the sequences of shSIRT6 ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 2× SYBR Green qPCR Mix Kit (TaKaRa, Japan) and the cDNA concentration and primers described above were used ...
-
bioRxiv - Immunology 2022Quote: ... before amplification using the Advantage 2 PCR kit (Clontech) and the SINGV6 primer (95°C for 1 min ...
-
bioRxiv - Bioengineering 2023Quote: ... quantified via qPCR (AAVpro Titration Kit version 2; Clontech), and stored at 4°C until use.
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Immunology 2023Quote: ... before whole transcriptome amplification using Advantage 2 Polymerase (Clontech) using oligos that introduce Illumina Nextera Multiplex Identifier (MID ...
-
bioRxiv - Neuroscience 2023Quote: ... and 2 μg/ml doxycycline (Clontech, cat. no. 631311). Neuronal induction media was changed once a day for 2 more days ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the Advantage® 2 PCR Kit (Takara Bio) in a touchdown cycling program as follows ...
-
bioRxiv - Plant Biology 2020Quote: ... according to the manufacturer’s instructions (SMARTer® RACE 5’/3’ Kit, Clontech, USA), with gene specific primers (YFT1-GSP5′-R/GSP3′-F ...
-
bioRxiv - Cell Biology 2021Quote: ... and 5’- GAGCTCTAGGATATCGAATTCTCGAGTCACTTGCACAGGGCCTCCAACACC-3’ and inserted into the pLVSIN vector (Takara Bio, Japan) by HiFi assembly (New England Biolabs ...
-
bioRxiv - Developmental Biology 2022Quote: ... For RACE analysis we used the SMARTer® RACE 5’/3’ Kit (Takara) according to manufacturer’s recommendations (see Supplementary Table 8 for the list of primers used).
-
bioRxiv - Neuroscience 2023Quote: ... and CaMKK2 (5’-CCCTTTCATGGATGAACGAAT-3’) were cloned into pBAsi-hH1 vector (Takara, 3220). pCAG-AMPKα1(WT ...
-
bioRxiv - Microbiology 2023Quote: ... The RACE experiment was carried out using SMARTer RACE 5’/3’ Kit (Clontech) according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... cDNA was synthesized using SMARTer RACE 5’/3’ Kit (Takara Bio, Shiga, Japan). ssRNA was converted into cDNA using SMARTer Universal Low Input RNA Kit according to the manufacturer’s protocol (Takara Bio) ...
-
bioRxiv - Physiology 2023Quote: 5’ and 3’ RACE assays were performed using a SMARTer RACE kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... and BFP/FAT-1/FAT-2 and T2A-NLS-mApple fragments were inserted with InFusion cloning (Takara Bio), as per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Microbiology 2021Quote: ... The extracellular SARS-CoV-2 RNA in the culture supernatant was analyzed using SARS-CoV-2 direct detection RT-qPCR kit (RC300A; TaKaRa-Bio, Shiga, Japan). The infectivity of SARS-CoV-2 in the culture supernatants was determined at 48 h post-infection ...
-
bioRxiv - Microbiology 2019Quote: ... (5’-GGT CTC TCT GGT TAG ACC AGA TCT GAG C-3’ and 5’-AAA CAT GGG TAT TAC TTC TGG GCT GAA AG-3’) using PrimeSTAR®HS (TAKARA) and purified by QIAquick Gel Extraction (QIAGEN) ...
-
Dynamic states of eIF6 and SDS variants modulate interactions with uL14 of the 60S ribosomal subunitbioRxiv - Biochemistry 2022Quote: ... pRSFDUET-1-EIF6 plasmid was co-transformed with pG-KJE8 expressing five bacterial chaperones (5-Ch: DnaK-DnaJ-GrpE, GroES, GroEL) or pG-TF2 expressing 3 bacterial chaperones (3-Ch: GroES, GroEL, TF) (Takara Biosciences) in BL21 (DE3 ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Immunology 2019Quote: ... Following the generation of cDNA using 5’RACE (rapid amplification of cDNA-ends; SMARTer RACE 5’/3’ Kit; Takara/Clontech), PCR amplification was performed using a Q5 polymerase (NEB ...
-
bioRxiv - Microbiology 2019Quote: ... A 500 ng of the RNA was used for the 5’RACE reaction with SMARTer RACE 5’/3’ kit (Clontech), according to manufacture’s instruction ...
-
bioRxiv - Molecular Biology 2023Quote: ... synthesized 5’ and 3’ fragments of the target RNA were 32P-radiolabeled at the 5’ end using T4 polynucleotide kinase (Takara). After gel purification ...
-
bioRxiv - Bioengineering 2021Quote: ... 1/3 volume Retro-X concentrator (Takara) was added ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 3 μM Shield-1 (Takara Bio) for indicated times ...
-
bioRxiv - Developmental Biology 2019Quote: ... 3×Flag-Adnp or HA-Ctnnb1 were subcloned into pTRE3G or pLVX-tight-puro expression vector (Clontech, PT5167-1 and PT3996-5) using In-fusion HD cloning system (Clontech ...
-
bioRxiv - Microbiology 2021Quote: ... Primers used for amplifying insert (5’- CACAGAGAACAGATTGGTGGATCCATGGTAGATATAAACAACAATAAGATTAG-3’ and 5’-GTGGTGGTGGTGGTGTAACTCGAGGAGATAACCTTGTACATCATCTGTAT GC-3’) contained 15-bp overhang with homology to the plasmid for InFusion cloning (Takara Bio, 638947). The resulting plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... with primers 5’-TCTTCCACTAGTGCCACCATGGCCACAGCTTGTAAAAGATC-3’ and 5’-TCTTCCGGATCCTTACAGCATGCCAAATCCTTTGG-3’ and subcloning into the SpeI and BamHI sites of the pLVX-IRES-mCherry vector (Clontech Cat#631237). HEK293T cells were transfected in 96-well using Lipofectamine 3000 Reagent (ThermoFisher ...
-
bioRxiv - Developmental Biology 2021Quote: ... filtered and concentrated by Lenti-X Concentrator (Clontech, PT4421-2) following the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 20ul mixed concentrations of 2 × ExTaq buffer (Takara, Japan), 0.8ul of each forward and reverse primer (10uM) ...
-
bioRxiv - Neuroscience 2020Quote: ... and 2 μg of pEGFP-C1 (Takara Bio, Shiga, Japan), together with 0.5 μg of expression plasmid for bcl-xl ...
-
bioRxiv - Plant Biology 2019Quote: ... were amplified and inserted into the pHIS 2 vector (Clontech) (NbCycB2proE ...
-
bioRxiv - Plant Biology 2019Quote: ... were amplified and inserted into the pHIS 2 vector (Clontech) (Nbwo-G1 ...
-
bioRxiv - Molecular Biology 2019Quote: ... reactions were performed using the Advantage 2 Polymerase Mix (Clontech) using the primers (Merck ...
-
bioRxiv - Neuroscience 2019Quote: ... Amplification was performed using Advantage GC 2 PCR kit (Clontech) and PCR products were cloned and sequenced.
-
bioRxiv - Microbiology 2021Quote: ... 10 μL of 2× One Step RT-PCR buffer (TaKaRa), and 5 μL ddH2O ...
-
bioRxiv - Genetics 2022Quote: ... 2 μL of DNA loading buffer (9157, TAKARA, Kusatsu, Japan) was added to the reaction and incubated at 65 ℃ for 5 min ...
-
bioRxiv - Immunology 2022Quote: ... into 96-well plates containing 2 µL Lysis Buffer (Clontech) supplemented with 1 U/μL RNase inhibitor (NEB) ...
-
bioRxiv - Biochemistry 2022Quote: ... restriction enzymes and DNA ligation kit ver.2 (Takara Bio); pET21a and E ...
-
bioRxiv - Developmental Biology 2023Quote: ... fbf-2 cDNA was cloned into the pGBTK vector (Clontech) and transformed into PJ68-4a yeast strain (MATa trp1-901 leu2-3,112 ura3-52 his3-200 gal4Δ gal80Δ LYS2::GAL1-HIS3 GAL2-ADE2 met2::GAL7-lacZ ...
-
VapC12 ribonuclease toxin modulates host immune response during Mycobacterium tuberculosis infectionbioRxiv - Microbiology 2023Quote: ... Real-time PCR was performed with 2 × SYBR mix (TaKaRa) in a QuantStudio-6 Flex Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Immunology 2022Quote: ... NETs were treated with 2 U micrococcal nuclease (Takara Bio) for 10 min at RT ...
-
bioRxiv - Immunology 2023Quote: ... and 2 μl SMART MMLV reverse transcriptase (Clontech, Takara Bio). The mixture was incubated under the following conditions ...