Labshake search
Citations for Takara Bio :
1 - 50 of 641 citations for 7 Benzothiazolemethanol 2 amino 6 methoxymethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: The amplified library was then recombined with pCMV FAS wt minigene exon 5-6-7 (Förch et al., 2000) using the In-Fusion HD Cloning kit (639649, Clontech) in a 1:8 vector:insert optimized ratio and transformed into Stellar competent cells (636766 ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Molecular Biology 2020Quote: ... cDNA was amplified by PCR in separate 25 μL reactions each containing 2 μL of cDNA for typically 7-9 cycles using 0.5 μL (2.5 u) LA Taq (Takara) with P5-3’ and miRCat-PCR-2 oligos (IDT ...
-
bioRxiv - Microbiology 2023Quote: ... sequence was replaced by that of virR (encoding amino-acids 1 to 164) or virRsol (encoding amino-acids 42 to 164) by In-Fusion HD cloning (Takara). PCR fragments were amplified using appropriate primer pairs (Table S1 ...
-
bioRxiv - Cell Biology 2020Quote: ... and the indicated Amino Acid Dropout mix (Clontech). Cultures were grown in 5 L flasks for 60 h ...
-
bioRxiv - Bioengineering 2021Quote: ... 7 μL RNase-free water (Takara, Japan), and 10 μL iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: DNA encoding the PX domain from the Qc SNARE Vam7 (Amino acyl residues 2-123) was amplified by PCR with CloneAMP HiFi PCR premix (Takara Bio USA, Mountain View, CA, USA). The amplified DNA fragment was cloned into BamHI and SalI digested pGST parallel1 vector (Sheffield et al.,1999 ...
-
bioRxiv - Developmental Biology 2022Quote: iPSCs SFCi55 and hESCs RUNX1-GFP were plated at 3 × 105 cells per a well of a 6 well plate and reverse transfected with 2 μg of DNA using the Xfect Transfection reagent (Clontech) and analyzed 2 days later.
-
bioRxiv - Cancer Biology 2022Quote: ... 4×106 B cells per well were plated in 2 mL on 6-well plates that had been coated with RetroNectin (25 μg/mL, 4°C, overnight; #T100B, Takara), blocked with 2% BSA in PBS (1h ...
-
bioRxiv - Cell Biology 2024Quote: iPSCs SFCi55 and hESCs RUNX1-GFP were plated at 3 × 105 cells per a well of a 6 well plate and reverse transfected with 2 μg of DNA using the Xfect Transfection reagent (Clontech) and analyzed 2 days later.
-
bioRxiv - Synthetic Biology 2023Quote: ... Activated T cells were transduced on day 1 after stimulation using combinations of PEG-precipitated retroviral concentrates encoding different constructs adsorbed onto non-tissue culture treated 6-well plates coated with anti-CD3/CD28 2 μg/mL each and retronectin 20 μg/mL (Takara, T100B) at 1-2×106 cells/well ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Systems Biology 2019Quote: MCF-7 Tet-On cells were purchased from Clontech and maintained as previously described (Liu et al. ...
-
bioRxiv - Immunology 2020Quote: ... Cells were counted and seeded at 3 million cells in 1 mL of media with 2x hIL-2 into each well of a 6 well plate that was coated with 15 µg/mL of RetroNectin (Takara, Cat# T100A) for 3 hours at room temperature and subsequently washed with 1x PBS ...
-
bioRxiv - Molecular Biology 2023Quote: ... with random 6 primers (TAKARA BIO). Thereafter ...
-
bioRxiv - Molecular Biology 2024Quote: ... HepG2-NTCP and Huh-7 cells with RNAi plus (TaKaRa, Japan) according to the manufacture’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, cat. no. 632180) were seeded in 9 mL DMEM (Gibco ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
Activity-dependent stabilization of nascent dendritic spines requires non-enzymatic CaMKIIα functionbioRxiv - Neuroscience 2022Quote: ... except 6-8 µg of DsRed-Express (Clontech) and 6 μg of mEGFP-tagged constructs or 5-10 μg of mEGFP were coated onto 6-7 mg of 1.6 μm gold beads ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Neuroscience 2021Quote: ... transfected at 5-7 DIV with the plasmid peGFP-N1 (Clontech, Mountain View, CA) using lipofectamine 2000 (ThermoFisher Scientific) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 15 pmol of siRNA is reverse transfected to 7×104 HeLa-Tetoff cells (Clontech) in a 12 well plate using 1.6 µl RNAiMAX (Thermo Fisher Scientific ...
-
bioRxiv - Immunology 2023Quote: 7 μg of lentiviral vectors was mixed with Lenti-XTM packaging single shots (Clontech) in a final volume of 600μl for 15min before the transfection mix were added to 4 million of Lenti-X TM 293T cells seeded on a 10 cm2 tissue culture dish ...
-
bioRxiv - Neuroscience 2021Quote: ... The plasmid called “CFP-Golgi” (containing amino acids 1–81 of ß-1,4glycosyltransferase) was originally purchased from Clontech.
-
bioRxiv - Cell Biology 2020Quote: ... The 10 amino acid duplication 3’ to GFP or mCherry2 on SHH protein was introduced using Infusion (Clontech) using primers (forward 5’TCCGGCGGCAGATCTGCAGAGAACTCCGTGGCGGCCAAATCCGGCGGCTGTTTCCCGG GA and reverse 5’ tcccgggaaacagccgccggatttggccgccacggagttctctgcagatctgccgccgga) ...
-
bioRxiv - Cell Biology 2020Quote: The N-terminal domain of dTBCE (amino acid 1 to 207) was cloned using the Infusion system (Takara) into pET23B (Clontech ...
-
bioRxiv - Biochemistry 2020Quote: One colony was used to inoculate 10mL of selection media (6.9 g/L Yeast Nitrogen Base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Biochemistry 2020Quote: ... Transformed cells were plated on a selection agar (6.9g/L yeast nitrogen base without amino acids, 0.62g/L Clontech -Leu/-Trp/-Ura dropout supplement ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2 µL of 2 mM dNTPs (Takara #4025), and 0.6 µL of 100% DMSO (NEB #12611P) ...
-
bioRxiv - Immunology 2023Quote: ... the non-tissue culture 24-well plates were coated with 7 μg/ml RetroNectin (TAKARA) for 3 hours at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: HaCaT cells were treated with the E-cadherin-blocking antibody (SHE78-7, Takara, Shiga, Japan), PY-60 (Axon Medchem ...
-
bioRxiv - Neuroscience 2020Quote: ... MEM (supplemented with non-essential amino acids) from HiMedia (India) and Tet system approved FBS was obtained from Takara Bio USA ...
-
bioRxiv - Developmental Biology 2019Quote: ... Full-length β-catenin and a C-terminal deletion of tle3b (NM_131780, complete reading frame after amino acid 210) were cloned in pGAD (Clontech). Combinations of plasmids to test two-hybrid interactions were co-transformed in Y2Gold yeast strain (Suppl ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... A plasmid encoding the G protein chimera GqGi3 bearing the core of human Gαq and the last 4 amino acid of Gαi3 was generated by primer mutagenesis and In-Fusion HD Cloning (Clontech) in a pcDNA3.1 vector ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) and purified using ProbeQuant G-50 Micro Columns (GE Healthcare ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 (TaKaRa) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 6-well plates of 70% confluent Lenti-X 293T(Clontech) cells were transfected with 1.5 μg of transfer vector ...
-
bioRxiv - Microbiology 2022Quote: ... spleen and intestine (infected C57BL/6) by using TRIzol (Takara) reagent according to manufacturers’ protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Gal4-VP16-human SREBP-1c plasmid was prepared by insertion of a VP16-transactivation domain fused to a human SREBP-1c fragment from the 431st amino acid to the C-terminus (amino acids 431-1123) downstream of the Gal4-DNA binding domain sequence in pM vector (Clontech). The Gal4-RE-Luc plasmid and luciferase plasmid including sterol response element (SRE-Luc ...
-
bioRxiv - Cell Biology 2021Quote: ... and LIM 3 (amino acids 361-421) were cloned into the multiple cloning site of pEGFP-N3 or pEGFP-C3 (Clontech) as previously described (Sala et al. ...
-
bioRxiv - Neuroscience 2021Quote: ... AP-MDGA1 and AP-MDGA2 were generated by replacing the V5 tag of the V5-MDGA1 and V5-MDGA2 constructs respectively by the 14 amino acids AP tag (5’GGCCTGAACGAtATCTTCGAGGCCCAG AAGATCGAGTGGCACGAG3’) using the HD-In-Fusion kit (Takara). The linker 5’GGAGGATCAGGAGGATCA3’ was added after the AP tag ...
-
bioRxiv - Cell Biology 2021Quote: ... Borr open reading frame corresponding to amino acids 113-221 was first amplified with a stop codon from LD36125 by PCR using PrimeStar (Takara) and cloned between AscI and NotI sites of pENTR (ThermoFisher ...
-
bioRxiv - Cell Biology 2021Quote: ... CPE 451 mCherry constructed by Gibson assembly by sub-cloning the 451 amino acids of CPE (without the Amphipathic Helix) into pmCherry-N1 (Clontech) vector using XhoI and BamHI restriction sites.As control vectors we used pEGFP-N3 and pmCherry-N1.All constructs were sequenced to confirm the fidelity of the process ...
-
bioRxiv - Neuroscience 2023Quote: ... inserting an in-frame 15bp flexible linker sequence (encoding the amino acids GGGGA) followed by EGFP at the C-terminus using Infusion cloning (Clontech). For the Tg(NBT:ap2s1-gfp ...
-
Molecular basis of proteolytic cleavage regulation by the extracellular matrix receptor dystroglycanbioRxiv - Biochemistry 2024Quote: ... A Flag tag x3 was inserted between amino acids 489 and 490 and a HA tag was inserted between amino acids 724 and 725 using In-Fusion Cloning Mix (Takara).