Labshake search
Citations for Takara Bio :
501 - 550 of 895 citations for 7 8 Dihydroisoquinolin 5 6H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... and mCherry was amplified from pTRE-Dual2 (Clontech # PT5038-5). pAF137 was constructed by amplifying the devil 41BB extracellular domain with primers pAF137-1.FOR and pAF137-1.REV and amplifying mCherry with pAF137-2a.FOR and pAF137-2.REV (Table S3-4) ...
-
bioRxiv - Plant Biology 2021Quote: ... After addition of 5 μL of TransIt transfection reagent (TaKaRa), the mixture was allowed to sit for an additional 5 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.2 μL ExTaq DNA polymerase (5 U/μL; Takara Bio), 40 ng of template DNA ...
-
bioRxiv - Biochemistry 2022Quote: ... roughly 5 million AAV pro293T cells (Takara, San Jose, CA) in 30 mL of media were seeded overnight in a T175 flask (Greiner Bio-One ...
-
bioRxiv - Cell Biology 2020Quote: ... cloned into the vector pAcGFP-N1 (Clontech plasmid PT3716-5), using transfection FuGENE HD® reagent at a ratio 5:1 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 5’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Cell Biology 2022Quote: ... the SCD medium was supplemented with 5 μM AureobasidinA (Clontech), diluted from a 5 mM stock solution (in ethanol ...
-
bioRxiv - Genetics 2022Quote: ... 5 units of Takara LA Taq (TaKaRa Bio USA, Inc.) and 1 μL of 100 μM PacBio universal primer ...
-
bioRxiv - Microbiology 2023Quote: ... 5 U μL-1 Taq DNA polymerase (Takara, CA, USA), 1x of PCR buffer (10x ...
-
bioRxiv - Cell Biology 2023Quote: ... with 5% foetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL−1 penicillin and 10 μg mL−1 streptomycin (Pen-Strep ...
-
bioRxiv - Biophysics 2023Quote: ... with 5% fetal bovine serum (tetracycline-free FBS, Takara Bio) and 10 U mL-1 penicillin and 10□μg mL-1 streptomycin (Pen-Strep ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Immunology 2022Quote: ... Real-time RT-PCR analyses for viral RNA copy number was carried out with One Step PrimeScript™ III RT-qPCR Mix (Takara, Cat# RR600B) and reactions were performed by using LightCycler® 96 System (Roche Diagnostics GmbH ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Plant Biology 2020Quote: ... four sequencing libraries (one for each tissue type) were constructed using the SMARTer PCR cDNA Synthesis Kit (ClonTech, Takara Bio Inc., Shiga, Japan) by tissue type with no size selection by NovoGene ...
-
bioRxiv - Molecular Biology 2020Quote: ... First-strand cDNA was synthesized with a PrimeScript™ RT synthesis kit with one-step genomic gDNA eraser kit according to instructions (TaKaRa, Tokyo, Japan). Gene-specific primer sets were designed based on the ORF ...
-
bioRxiv - Plant Biology 2021Quote: ... Reverse transcription was then carried out using total RNA and oligo-dT primers to synthesize the first strand cDNA using the PrimeScript One-Step RT-PCR Kit (Ver.2, Takara Biotechnology, Dalian, China) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... for 15 min and then harvested for quantification of INF α mRNA using the One-step SYBR Prime script RT-PCR kit (TaKaRa, Dalian, China) according to the manufacturer’s protocol.Briefly the total RNA was isolated from TNF-α-treated with Trizol reagent (Takara Bio ...
-
bioRxiv - Microbiology 2023Quote: ... and real-time RT-PCR was performed by targeting the SARS-CoV-2 RdRp gene as follows: each 20 µl sample consisted of 12.5 µl One Step PrimeScript™ III RT-PCR Kit (Takara Bio, Shiga, Japan), 0.5 µM Sars-CoV-2 CRV forward primer (5’-TCACCTAATTTAGCATGGCCTCT-3’) ...
-
bioRxiv - Neuroscience 2023Quote: ... Each of the four pools was converted into one Illumina-barcode indexed sequencing library using the ThruPLEX DNA-Seq HV kit (Takara Bio Catalog# R400740), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... One microgram of total RNA was used for complementary DNA (cDNA) synthesis by PrimeScript first strand cDNA synthesis kit (TAKARA-Bio, Cat# 6110) using an oligo(dT ...
-
bioRxiv - Genomics 2019Quote: ... The Agilent 2100 Bioanalyzer was used to assess RNA quality and only high-quality RNA (RIN > 8) was further processed for cDNA synthesis with SMART-Seq v4 Ultra Low Input RNA Kit (Clontech cat. 634888) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 µg of high-quality total RNA (RNA integrity number > 8) was fragmented in the presence of Mg2+ in SMARTScribe Reverse Transcriptase buffer (Clontech, Cat. 639537), and mRNA fragments with a poly(A ...
-
bioRxiv - Neuroscience 2023Quote: ... Arr3 and Arr3-derived constructs were detected with rabbit anti-Arr3 (Ahmed et al., 2007) or mouse anti-GFP (Clontech JL-8) antibody ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Pathology 2019Quote: ... adenoviral vectors expressing GFP (Ad-GFP) and human PERK (Ad-PERK) were constructed using a one-step Adeno-X-ZsGreen adenoviral system (632267; Takara Bio, Mountain View, CA) following manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... Overnight primary antibody incubation was done at 4°C with one or more of the following antibodies in blocking buffer: rabbit anti-DsRed (Takara Bio, 632496, 1:500), goat anti-mCherry (Sicgen ...
-
bioRxiv - Immunology 2024Quote: ... one containing Mu Mx1 and one containing the Tol2 transposase were transfected into DF1 cells at 50-70% confluency using Xfect transfection reagent (Takara Bio, San Jose, CA) at a 5:1 ratio respectively ...
-
bioRxiv - Cell Biology 2019Quote: ... for 30 min at 37°C in a moisture chamber followed by an incubation with anti-GFP (1:100 in PBSA) antibody at 4°C for 72 h (Takara 632381/JL-8)) ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected with relevant siRNA were seeded on to 8–well chamber slides and treated with 1 μM Sheild1 (632189, Clontech Laboratories UK Ltd) and 1 μM 4–hydroxytamoxifen (4–OHT ...
-
bioRxiv - Genetics 2019Quote: ... and performed the 2nd round of PCR to attach to the libraries adaptor and index sequences for the NGS analysis for 8 cycles again with Tks Gflex™ DNA Polymerase (Takara, Cat#R060A). The DNA sequences of the adaptor/index primers are listed in Table S6 ...
-
bioRxiv - Molecular Biology 2020Quote: RACE assay was performed with SMARTer RACE 5’/3’ kit (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... A/C Heterodimerizer AP21967 (Takara Bio, 500 nM for 5 hours), Okadaic Acid (Santa Cruz Biotechnology ...
-
bioRxiv - Plant Biology 2020Quote: The assay was performed using the 5’-Full RACE kit (TaKaRa) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... coli BL21 and purified on 5 mL Talon column (Clontech®) loaded with Cobalt ...
-
bioRxiv - Cell Biology 2021Quote: ... Clarified lysate was incubated with 5 mL TALON beads (Takara Bio), washed with 150 mL lysis buffer and eluted in 22 mL of elution buffer (25 mM Hepes pH 7.5 ...
-
bioRxiv - Molecular Biology 2022Quote: ... and deoxyribonuclease I (DNase I, 5 units/mL, Takara, Shiga, Japan) for 15 min ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 5 μl of 2× SYBR Premix Ex Taq II (TaKaRa), 1 μl of cDNA ...
-
bioRxiv - Immunology 2019Quote: ... The diafiltrated medium was loaded onto 5 ml Talon resin (Clontech), washed with 10 CV of 250 mM NaCl ...
-
bioRxiv - Immunology 2021Quote: ... 5’ RACE was performed with SMARTer RACE cDNA Amplification Kit (Clontech). IgG /IgK/IgL NGS libraries were made by using NEBNext Ultra DNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Neuroscience 2021Quote: ... The SMARTer® RACE 5’/3’ Kit was purchased from Clontech Laboratories ...
-
bioRxiv - Microbiology 2020Quote: ... and 5 µL of the ligation mix (Takara Ligation Kit 6023), and then placing the tubes into a heat block at 90 °C for 15 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 μl 2×SYBR®Premix Ex Taq™ II (TaKaRa), 0.75 μM primers and nuclease-free water to 20 μl ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 μL of 5× PrimeSTAR GXL Buffer (Takara Bio, Kusatsu, Japan), 1.0 μL of PrimeSTAR GXL DNA Polymerase (1.25 U/μL) ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were incubated with D/D-Solubilizer (5 μM, Clonetech/Takara) and Cycloheximide (35.54 μM ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... SMARTer® RACE 5’/3’ Kit was used (Takara Bio, Japan). Prior to the reaction ...
-
bioRxiv - Cell Biology 2024Quote: ... Supernatants were loaded on 5 mL of TALON beads (Takara Bio) pre-equilibrated with the lysis buffer ...
-
bioRxiv - Molecular Biology 2024Quote: ... and the human herpes simplex virus 5 puromycin resistance marker (Clontech).
-
bioRxiv - Neuroscience 2021Quote: 8 DIV (days in vitro) neurons were transfected with 1.5 µg of pEGFP-N1 vector (Clontech Laboratories, Takara Bio Inc., Mountain View, CA, USA) or pEGFP-N1-TG2 vector (Furini et al. ...