Labshake search
Citations for Takara Bio :
51 - 100 of 2351 citations for 7 Diethylamino 3 nitro 2H 1 benzopyran 2 one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... medium and 10-fold dilutions of these cultures were dropped on SD control (−2) and selective medium additionally lacking His (−3) (Clontech). Empty vectors were used as negative controls ...
-
bioRxiv - Cell Biology 2023Quote: ... Fractionated CD34+ cells from Animals #2 and #3 were cultured overnight on RetroNectin-coated plates (Takara, T100B, Mountain View, CA) in X-VIVOTM 10 (Lonza ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Developmental Biology 2020Quote: ... anti-E-Cad 1:200 (M108, clone ECCD-2, TaKaRa), anti-Nanog 1:200 (eBIO-MLC51) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and glyceraldehyde 3-phosphate dehydrogenase (5′-GCACCGTCAAGGCTGAGAAC-3′ and 5′-TGGTGAAGACGCCAGTGGA-3′; Takara Bio Inc., Shiga, Japan) were used for RT-PCR.
-
bioRxiv - Developmental Biology 2020Quote: ... was cloned into pLVX Tet-One Puro plasmid (Clontech), packaged in 293T cells (from ATCC ...
-
bioRxiv - Molecular Biology 2023Quote: ... in a Mupid-One gel electrophoresis system (TaKaRa, Japan). RNA samples were purified for the second time by the TRIzol method as mentioned above and were stored at −80°C until further analysis.
-
bioRxiv - Cell Biology 2023Quote: ... 14-3-3τ and β-actin were designed and synthesized by Takara (Table 1). To run the real-time PCR reaction ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... 3 (Takara, Shiga), which is capable of resistance/nonspecific amplification and smear suppression against such PCR-inhibiting substances ...
-
bioRxiv - Immunology 2023Quote: ... Lentivirus-containing supernatant was harvested on days 2 and 3 after transfection and then concentrated using a Lenti-X concentrator (Clontech, 631232). HEK-293T cells were transfected with the expression vectors according to the manufacturer’s protocol with PEI 2500 (BioScientific) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the U2OS 2-6-3 cells expressing degron-tagged LacI fusion proteins were incubated with 300 nM Shield1 ligand (Takara Bio) and 1 µg/mL doxycycline for 24 hours ...
-
bioRxiv - Microbiology 2023Quote: ... 5 μL of extracted RNA was subjected to one-step real-time RT-PCR using a One Step PrimeScript™ RT-PCR Kit (Perfect Real Time) (TaKaRa Bio Inc.) on a QuantStudio 5 Real-Time PCR system (ThermoFisher Scientific) ...
-
bioRxiv - Microbiology 2023Quote: ... The extracted RNAs were subjected to one-step real-time PCR using the One Step PrimeScript™ RT-PCR Kit (Perfect Real Time) (TaKaRa Bio Inc.).
-
bioRxiv - Plant Biology 2023Quote: ... The yeast two-hybrid and one-to-one confirmation experiments were performed according to Matchmaker™ Gold Yeast Two-Hybrid System User Manual (Clontech, https://www.clontech.com/). Primers for vector construction were listed in Table S8.
-
bioRxiv - Molecular Biology 2024Quote: ... HepG2-NTCP and Huh-7 cells with RNAi plus (TaKaRa, Japan) according to the manufacture’s protocol ...
-
bioRxiv - Microbiology 2020Quote: ... HSV-1 was pretreated with 2 μg/ml DNase (Takara, Japan), and then diluted to MOI=20 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Confirmatory “1-to-1” pairwise assays for selected interactants were performed with the MatchMaker Two-Hybrid System 3 (Clontech Inc.)
-
bioRxiv - Microbiology 2020Quote: ... or Oligo dT-3 sites Adaptor Primer for 3’ RACE (Takara). To analyze the complete BToV genome ...
-
bioRxiv - Microbiology 2022Quote: RT-PCR was performed in a single closed tube using a one-step RT-PCR kit (One Step PrimeScript III RT-qPCR Mix, with UNG; Takara Bio Inc., Kusatsu, Japan) in accordance with the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... the annealed oligo duplex at a 1:3 mol ratio and ligation mix (Takara Bio) at 16 °C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: 1 x 106 ACKP cells were transfected with 3 µg pE2F-TA-luc plasmid (Takara) and 0.3 µg renilla luciferase control plasmid pRL-CMV (Promega ...
-
bioRxiv - Developmental Biology 2020Quote: ... templates were constructed by cloning the 2 kb 5’ and 3’ homology arms into pPD95.77 plasmids using In-Fusion Advantage PCR cloning kit (Clontech, cat. no. 639621). We used the CRISPR design tool (http://crispr.mit.edu ...
-
bioRxiv - Molecular Biology 2021Quote: ... The One-step PrimeScript miRNA cDNA Synthesis Kit (Takara, Japan) was utilized for reverse transcription ...
-
bioRxiv - Systems Biology 2019Quote: ... Lenti-X™ Tet-One™ Inducible Expression System (Clontech) was used ...
-
bioRxiv - Developmental Biology 2020Quote: ... PrimeScript II High Fidelity One step RT-PCR Kit (Takara) was used with the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... 7 million Lenti-X HEK-293T cells (Takara Bio, cat. no. 632180) were seeded in 9 mL DMEM (Gibco ...
-
bioRxiv - Pathology 2020Quote: The viral loads of WHCV in BALF of patient 1 were determined by quantitative real-time RT-PCR with Takara One Step PrimeScript™ RT-PCR Kit (Takara RR064A) following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3’RACE kit (Takara) was used to convert RNAs of the prostate tumors into cDNAs by a reverse transcriptase and oligo-dT adapter primer ...
-
bioRxiv - Immunology 2021Quote: ... containing 2 μl lysis buffer per well (1:20 RNase inhibitor (Clontech) in 0.2% (v/v ...
-
bioRxiv - Immunology 2022Quote: 5’ and 3’ RACE was performed with SMARTer RACE 5’/3’ Kit (Takara) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were grown one more day in NDiff 227 media (Takara) supplemented with 1 µM PDO325901 and 3 µM CHIR99021 (NDiff + 2i) ...
-
bioRxiv - Biochemistry 2021Quote: ... One-step PrimeScript™ RT Reagent Kit (Takara, Japan, Cat.#RR064A) Kit were used for quantitative real-time PCR ...
-
bioRxiv - Microbiology 2020Quote: ... One step TB green Primescript RT-PCR kit II (Takara, RR086B) was used for qPCR reaction on Quantstudio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... pombe genome using KOD One DNA polymerase (TaKaRa Bio Inc., Japan). The first PCR products were used as primers in the second PCR step to amplify a cassette for integration ...
-
bioRxiv - Microbiology 2020Quote: ... A mouse 7-day embryo cDNA Library (CATALOG No. 630478; Clontech Laboratories, Inc.) was used to identify host interaction proteins of Mtb PknG through yeast two-hybrid assay ...
-
bioRxiv - Microbiology 2021Quote: ... 1 μl of cDNA was amplified using Advantage HF 2 DNA polymerase (Takara) for 25-30 cycles according to the manufacturer’s instructions (Fw 5’-GGGATTAAAGGTTTATACCTTCCC-3’ and Rv 5’-TCGTTGAAACCAGGGACAAG-3’) ...
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 40 μg mL−1 5-Bromo-4-Chloro-3-Indolyl-beta-D-Galactosidase (X-gal, Takara Bio), and 500 μM isopropyl beta-D-1-thiogalactopyranoside (IPTG ...
-
bioRxiv - Neuroscience 2023Quote: ... Overnight primary antibody incubation was done at 4°C with one or more of the following antibodies in blocking buffer: rabbit anti-DsRed (Takara Bio, 632496, 1:500), goat anti-mCherry (Sicgen ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...
-
bioRxiv - Microbiology 2022Quote: ... RT-qPCR was performed using One-Step PrimeScript RT-PCR Kit (Takara).
-
bioRxiv - Pathology 2021Quote: ... and the Quant-X One-Step qRT-PCR TB Green Kit (Takara). A Lenti-X RNA Control Template was provided by the kit and served to build a standard curve of viral genome copies ...