Labshake search
Citations for Takara Bio :
301 - 350 of 2411 citations for 7 Diethylamino 3 ethylamino 2 methylphenoxazin 5 ium tetrachlorozincate 2 1 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... Whole transcriptome amplification (WTA) was performed with Advantage 2 polymerase (Takara Bio). WTA reactions were monitored with qPCR to determine optimal cycle number ...
-
bioRxiv - Synthetic Biology 2021Quote: ... After 2 days of incubation on selective media (SC-URA/630314/CLONTECH) at 30°C ...
-
bioRxiv - Microbiology 2021Quote: ... cerevisiae strain BJ5464 using protocol Yeastmaker™ Yeast Transformation System 2 (Clontech). The transformants were screened on yeast nitrogen base (YNB ...
-
bioRxiv - Cell Biology 2022Quote: ... The cells were then treated with 2 μg/mL puromycin (Clontech; 631306) under selection for at least 1 week ...
-
bioRxiv - Neuroscience 2022Quote: ... Lentiviruses were purified and concentrated using the LentiX Concentrator (Clontech, PT4421-2) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... 2.5 mM dNTP and 2 U/μL of recombinant RNase inhibitor (Clontech) then spun down and frozen at-80°C ...
-
bioRxiv - Genetics 2023Quote: ... cDNA was amplified and purified using an Advantage 2 PCR Kit (Clontech). The cDNA library was sequenced using an Illumina sequencing platform (NovaSeq6000) ...
-
bioRxiv - Biophysics 2023Quote: ... The supernatant was incubated with 2 ml Ni-IDA resin (Takara Bio) for 2 hrs at 4°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 different reporters were tested in parallel: pE2F-TA-Luc (Clontech/Takara) to measure E2F transcriptional activity (repressed by Rb) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 2 different reporters were tested in parallel: pE2F-TA-Luc (Clontech/Takara) to measure E2F transcriptional activity (repressed by Rb) ...
-
bioRxiv - Microbiology 2024Quote: ... according to the supplier’s protocol (ClonTech; Protocol-at-a-Glance, PT5056-2). The E.coli strains were cultured in LB broth medium supplemented with ampicillin ...
-
bioRxiv - Cancer Biology 2023Quote: ... then cells were selected with 2 μg/ml puromycin (631306; Takara Bio) or 500 μg/ml geneticin (10131027 ...
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Cell Biology 2023Quote: ... A total of 1-2 μg RNA was reverse transcribed with random hexamers using PrimeScript 1st strand cDNA synthesis kit (Takara Bio, Japan) per the manufacturer’s protocol on Verti 96 well thermocycler (Thermo Scientific ...
-
bioRxiv - Bioengineering 2021Quote: ... 7 μL RNase-free water (Takara, Japan), and 10 μL iQ SYBR Green Supermix (Bio-Rad ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.3 grams or more of brain tissue was thawed on ice for 5 minutes with 5 ml of nuclei buffer (NB): 1% BSA containing 0.2 U μl−1 RNase inhibitor (Takara, 2313A) and EDTA-free Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Evolutionary Biology 2019Quote: Templates for mRNA in situ hybridization probes were cloned by PCR or SMARTer 3’/5’-RACE (Clontech) from cDNA or genomic DNA (see Supplemental File 1 for details) ...
-
bioRxiv - Cell Biology 2023Quote: ... pseudonana (PtPyShell1, TpPyShell1, and TpPyShell2) were determined by RACE using a SMARTer RACE 5’/3’ kit (TaKaRa). Sequences were amplified by PCR and cloned into pPha-T1 or pTha-NR vectors containing a fragment of enhanced GFP by a seamless ligation cloning extract method (Motohashi ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl 5× In-Fusion Enzyme Mix (Takara) were mixed in a total of 5 µl H2O ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Its male-specific exon was amplified using Advantage® 2 Polymerase Mix (TaKaRa), the gene-specific primer “Cpun_dsx OD2 3’RACE” ...
-
bioRxiv - Genomics 2019Quote: ... Retroviruses were packed using the EcoPack 2-293 cells (Clontech, Mountain View, CA) and infections were performed as described12 ...
-
bioRxiv - Microbiology 2021Quote: ... cDNA molecules were amplified using the Advantage 2 PCR kit (639206, Takara Bio) with initial denaturation at 95 °C for 1 min ...
-
bioRxiv - Microbiology 2020Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and gene-specific primers ...
-
bioRxiv - Cell Biology 2021Quote: ... Primer sequences (Table 2) were verified using total human kidney RNA (Takara Bio). PSMB4 was determined as the most stable housekeeping gene using the method described by Xie ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA was synthesized by adding 2 μl of PrimeScriptTM RT reagent kit (TaKaRa) to 500μg of RNA samples in 8 μl of distilled water (DW ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative real-time PCR was carried out using 2× TB-Green premix (TaKaRa) on a LightCycler-480®II (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and either 2 μg of the Tet-On-3G transactivator (pLVX Tet3G, Clontech) or 2 μg of the pLenti-CMVtight-Hygro-DEST plasmid with each cDNA of interest ...
-
bioRxiv - Biochemistry 2023Quote: ... the supernatant was incubated for 2 hr with TALON metal affinity resin (Takara) pre-equilibrated with 50 mM Tris-HCl [pH 7.6] ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviral titers were measured using Lenti-X GoStix (PT5185-2; Clontech, Takara Bio) following instructions provided by the manufacturer ...
-
bioRxiv - Molecular Biology 2024Quote: ... Lentiviral titers were measured using Lenti-X GoStix (PT5185-2; Clontech, Takara Bio) following instructions provided by the manufacturer ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 2 µl of lysate was used for PCR using SapphireAMP (Takara, RR350) and primers specific for each gene ...
-
bioRxiv - Cell Biology 2020Quote: ... for 1 h at 4 °C with rotation and then transferred to gravity columns (Talon® 2 ml Disposable Gravity Column, Clontech, #635606-CLI). The lysate was drained and the beads were washed five times with cold wash buffer (50 mM Tris ...
-
bioRxiv - Neuroscience 2023Quote: ... were transiently cotransfected with a 2:1 mixture of Nav1.7-expressing plasmid8 and a pIRES2-ZsGreen bicistronic plasmid (Takara Bio, San Jose, CA) expressing ZsGreen and mouse FHF2B proteins.10 The same pIRES2-ZsGreen plasmid without FHF2 coding sequence served as the control ...
-
bioRxiv - Biochemistry 2024Quote: ... Sub-library specific primers were then used to amplify 1 ul of cDNA template for 24 cycles using Advantage 2 PCR Mix (Takara Bio, Cat. 639206). Finally ...
-
bioRxiv - Microbiology 2020Quote: ... cDNA was generated following the SMARTer® 5’/3’ RACE kit protocol (Takara Bio, Kusatsu, Shiga Prefecture, Japan).
-
bioRxiv - Plant Biology 2022Quote: ... and His (-HTLA) but containing 5-bromo-4-chloro-3-indolyl α-D-galactopyranoside (Clontech, Madison, WI, USA). As a control ...
-
bioRxiv - Developmental Biology 2022Quote: Rapid amplification of cDNA end (RACE) was performed using the SMARTer® RACE 5’/3’ Kit (Takara, #634858). 1ug of freshly isolated RNA from E8.5 embryo hearts was used to generate first strand cDNA according to the manufactural protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... and histidine (H) and containing 5-Bromo-4-Chloro-3-Indolyl α-D-galactopyranoside (X-α-gal) (Clontech) to detect interactions ...
-
bioRxiv - Cell Biology 2023Quote: ... the single-stranded DNA (5’-AATTCAAAGAATTAACCTTAATTGAA GGGGAGGGTTCAGTACTTTTGTGTAGTACAAATATCAGTACTTTTGTGTAGTACAAAA GGGAGGGCTTCAATTAAGGTTAATTCTTTG-3’) was treated with T4 DNA ligase (Takara, Beijing, China) after annealing ...
-
bioRxiv - Plant Biology 2023Quote: ... Ade and His but containing 5-Bromo-4-Chloro-3-indolyl a-D-galactopyranoside (X-a-gal) (Clontech). To detect interactions ...
-
bioRxiv - Molecular Biology 2023Quote: ... The 5’ and 3’ ends of the cDNA were amplified using the SMARTer RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s guidelines ...
-
bioRxiv - Cell Biology 2023Quote: The full-length cDNA expression library was constructed using the SMARTer RACE 5’/3’ Kit (Takara Bio, 634858) according to the manufacturer’s instructions for the In-Fusion SMARTer Directional cDNA Library Construction Kit (Takara Bio ...
-
bioRxiv - Immunology 2022Quote: ... or the expression vector LentiCRISPRv2 (coding for guideRNA) in a 3:1:3 ratio for 8 hours using calcium phosphate transfection (CalPhos Mammalian Transfection Kit, Takara Bio Europe ...
-
bioRxiv - Microbiology 2021Quote: ... The knockout construct was developed through In-Fusion using the purified amplicons based on the manufacturer’s instructions with the insert to vector ratio of 2:1 (Takara Bio, Mountain View, CA, USA) and transformed into E ...
-
bioRxiv - Neuroscience 2020Quote: ... TetO/NGN2 gene expression was induced by Doxycycline (2 μg/mL; Clontech, Madison, WI) on day 0 ...
-
bioRxiv - Immunology 2022Quote: ... 2 μl of the pre-RT-PCR2 (PrimeScript™ II Reverse Transcriptase, Takara Bio) mix was added to each well ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5.0 μL of 2×SYBR® Premix Ex Taq™ II (TaKaRa, Dalian, China), and 3 μL deionized water ...
-
bioRxiv - Plant Biology 2021Quote: ... The Yeastmaker Yeast Transformation System 2 was used according to the manufacturer’s instructions (Clontech). pGBK-53 and pGADT were used as positive controls ...
-
bioRxiv - Biochemistry 2022Quote: ... cDNA was produced from 2 mg overall RNA with AMV reversed transcriptive enzyme (TaKaRa) as per the supplier’s instruction ...