Labshake search
Citations for Takara Bio :
251 - 300 of 1179 citations for 7 3 Bromopropoxy quinoline 2 1H one since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... a one-step reverse transcription-PCR (RT-PCR) assay was conducted with a PrimeScript kit (Takara, Tokyo, Japan), and Viral genomic terminal sequences were determined using commercial 5’ and 3’ RACE (rapid amplification of cDNA ends ...
-
bioRxiv - Immunology 2020Quote: ... q-RT-PCR was performed using the One Step PrimeScript™ RT-PCR Kit (Perfect Real Time; TaKaRa). The primers used for q-RT-PCR were selected to be specific for the E and ORF1ab sequences in the SARS-CoV-2 genome (Table 1) ...
-
bioRxiv - Bioengineering 2021Quote: ... One microgram of RNA was reverse transcribed into cDNA using a PrimeScript™ RT reagent Kit (TaKaRa, RR037A) in a 20 μl reaction ...
-
bioRxiv - Molecular Biology 2019Quote: ... One microgram of total RNA was reverse transcribed to cDNA using RevertAid First Strand cDNA Synthesis Kit (TaKaRa) and stem-loop primers ...
-
bioRxiv - Plant Biology 2021Quote: ... one microgram of DNase-treated RNA was used for reverse transcription using a PrimerScript RT reagent kit (Takara) and a mix of oligo poli-dT and random hexamers ...
-
bioRxiv - Microbiology 2022Quote: ... qRT-PCR was performed using the One Step TB Green PrimeScript PLUS RT-PCR Kit (RR096A, TaKaRa, Japan) and a Thermal Cycler Dice Real Time System TP800 (TaKaRa ...
-
bioRxiv - Synthetic Biology 2024Quote: ... One µg of total RNA was processed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China). Amplified products were sequenced and verified after cloning into a pJET1.2-T vector through CloneJET PCR Cloning Kit (Thermo Scientific ...
-
bioRxiv - Physiology 2024Quote: ... Three volumes of concentrated virus medium were subsequently mixed with one volume of Lenti-X concentrator (Takara Bio) and rotated at 4°C overnight before centrifugation (1500 g for 45 min at 4°C) ...
-
bioRxiv - Zoology 2024Quote: ... One µg of total RNA was processed using PrimeScript RT reagent Kit with gDNA Eraser (Takara, Beijing, China). The PCR procedure was set as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... we confirmed successful repair by extracting mRNA and performing one step RT-PCR (Takara Primescript High Fidelity, RR057B). Primer sequences and design are detailed in Supplementary Fig 1 ...
-
bioRxiv - Immunology 2024Quote: ... A stable IFN-λ-expressing cell line was obtained by transfection of one million Lenti-X (HEK293T, Takara) cells with 500 ng Super PiggyBac Transposase vector and 1250 ng of PiggyBac transposase mammalian expression vector using Lipofectamine 3000 following to the manufactureŕs instructions ...
-
bioRxiv - Molecular Biology 2019Quote: HEK293 cells were transfected with p122RhoGAP/DLC-1 siRNA (sense, 5′-GAAACGCCUUAAGACACUATT-3′; antisense, 5′-UAGUGUCUUAAGGC GUUUCTT-3′; TaKaRa Biotechnology Co., Ltd., Kyoto, Japan), IQGAP1 siRNA (s16837 ...
-
bioRxiv - Plant Biology 2023Quote: The cDNA prepared from 10-day-old OsbZIP48OE seedlings was used to perform 5’ and 3’ RACE using SMARTer® RACE 5’/3’ Kit (Clontech, TaKaRa Bio, USA) as per manufacturer’s instructions followed by Sanger based sequencing of the RACE products ...
-
bioRxiv - Neuroscience 2023Quote: ... 5′-GCATGTCACGATGTTACAA-3′ and 5′-GGATGAAATGAAGGTGCTA-3′ as previously described50 and were inserted using the Infusion HD Cloning kit (Takara Bio USA Inc, NC1470242).
-
bioRxiv - Cancer Biology 2023Quote: Coding regions of the heavy-chain variable domains were amplified with two PAGE-purified primers (CALL001: 5’-GTCCTGGCTGCTCTTCTACAAGG-3’ and CALL002: 5’-GGTACGTGCTGTTGAACTGTTCC-3’) using LA Taq polymerase (TAKARA Bio Inc., Shiga, Japan). The amplified fragments were separated on a 1.5% low-melting-temperature agarose gel (Lonza Group AG ...
-
bioRxiv - Immunology 2019Quote: CpG-ODN 2007 (5’-TCGTCGTTTTGTCGTTTTGTCGTT-3’) were synthesized by Takara Biotechnology (Dalian ...
-
bioRxiv - Plant Biology 2019Quote: ... Y2H assays were performed using the Matchmaker 3 system (Clontech). The resulting transformants with appropriate positive and negative controls were spotted on SD (-Leu/-Trp ...
-
bioRxiv - Cancer Biology 2020Quote: ... using the SMARTer™ ICELL8 3’ DE Kit (Takara Bio). Processing 8 samples at a time ...
-
bioRxiv - Systems Biology 2019Quote: ... and 3× PrimeScript enzyme mix (Cat# RR037A, TAKARA Bio INC) in RNase-free water ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... The 3’-RACE PCR was performed with ExTaq polymerase (TaKaRa) using the following primers ...
-
bioRxiv - Neuroscience 2023Quote: ... supplemented with 1/3 volume Lenti-X Concentrator (Takara 631232), mixed by gentle inversion ...
-
bioRxiv - Microbiology 2024Quote: The SMARTer® RACE 5’/3’ kit (Takara Bio, USA) was used to generate cDNA according to the manufacturer’s instructions using a maPgV-specific reverse primer (TGCGAGAGCCGTCAGCCACA) ...
-
bioRxiv - Cell Biology 2024Quote: Human fetal heart RNA (n=3 pooled, Cat #636532, Takara) and human adult heart RNA (n=4 pooled ...
-
bioRxiv - Physiology 2019Quote: ... to perform 5′ and 3′ rapid amplification of cDNA ends (RACE)-PCR utilizing the Clontech SMARTer 5′/3′ RACE Kit (Takara BIO USA Inc, CA, USA) as recently described58 ...
-
bioRxiv - Molecular Biology 2022Quote: ... ceranae-inoculated workers’ midguts at 7 dpi and 10 dpi were respectively isolated using RNA Extraction Kit (TaKaRa company, Dalian, China). cDNA was synthesized through reverse transcription with oligo dT primer and used as templates for qPCR assay ...
-
bioRxiv - Molecular Biology 2019Quote: The MCF-7 cell line (ATCC, Manassas, VA, USA) was stably transfected with peGFP-C1 vector (Clontech, Mountain View, California, USA) containing the GFP-Rab27b fusion protein ...
-
bioRxiv - Neuroscience 2021Quote: ... Cells were cotransfected with hSyn-DsRed and the indicated construct on DIV 7 or DIV 19 (for older neurons) with 1 μg total purified plasmid DNA via CalPhos Mammalian Transfection Kit (Takara Bio) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2024Quote: For immunostaining the following antibodies were used: mouse anti-E-cadherin mAb clones SHE78-7 and HECD1 (Takara, M126 and M106), mouse anti-vinculin (Sigma ...
-
bioRxiv - Immunology 2024Quote: ... Cultures were harvested after 7 days and Fabs were purified from culture supernatant using His60 Ni Superflow resin (Takara Bio #635660). Fabs were eluted from the column using a buffer of 50 mM Tris ...
-
bioRxiv - Cancer Biology 2020Quote: ... phospho-specific mutant constitutively active NFATC4 17 was also cloned into the doxycycline-inducible Tet-One expression system (Clontech) to create an inducible and constitutive NFATC4 (IcNFATC4 ...
-
bioRxiv - Immunology 2021Quote: ... and one deletion mutant Δ39-59 were made by mutation PCR with PrimerSTAR Max DNA Polymerase (Takara, Beijing, China) and pdsRed-p17 as the template ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized using a PrimeScript II High Fidelity One Step RT-PCR Kit (R026A, Takara Bio, Shiga, Japan), purified using a QIAquick PCR Purification Kit (QIAGEN ...
-
bioRxiv - Biophysics 2021Quote: ... using KOD One PCR Master Mix (TOYOBO) was subcloned into the AgeI- and NotI-digested EGFP-N1 vector (Clontech), and subsequently full-length EGFR fragment was subcloned into the NheI- and HindIII-digested the LgBiT-inserted EGFP-N1 vector ...
-
bioRxiv - Biochemistry 2022Quote: One μg of RNA per kidney half was reverse-transcribed using PrimeScript RT Reagent kit (RR037 TAKARA, Shiga, Japan). Two μl of cDNA was used for quantitative real-time PCR to assess gene mRNA expression ...
-
bioRxiv - Molecular Biology 2019Quote: ... One microgram of total RNA was used for preparing cDNA using PrimeScript™ 1st strand cDNA Synthesis Kit (Clontech) following the manufacturer’s protocol.
-
bioRxiv - Molecular Biology 2021Quote: ... One microgram of total RNA was reverse transcribed by the PrimeScript RT Reagent Kit with gDNA Eraser (Takara, RR047A). Quantitative PCR was performed in technical duplicates with FastStart Essential DNA Green Master Mix (Roche ...
-
Guidelines for accurate genotyping of SARS-CoV-2 using amplicon-based sequencing of clinical samplesbioRxiv - Genomics 2020Quote: ... CDC-USA assay targeting gene N (IDT # 10006713) and One Step PrimeScript™ III RT-PCR Kit (TaKaRa #RR600A). Serial dilutions of reference material were prepared ranging from 1 to ~10M genome equivalents per reaction ...
-
bioRxiv - Evolutionary Biology 2020Quote: The water-in-oil droplets after the incubation step were diluted 10000-fold with 1 mM EDTA (pH 8.0) and subjected to RT-qPCR (PrimeScript One Step RT-PCR Kit (TaKaRa)) with primer 1 and 2 after heating at 95 °C for 5 min ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Neuroscience 2021Quote: ... 5’ UTR and EGFPd2 sequences were cloned in the multiple cloning site of pTet-One vector (Takara-Clontech, 634301). DG NSC Droshafl/fl cells were brought in suspension by incubating with 0.25% trypsin (Gibco #15090 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The measurement was performed after diluting the droplets 100-fold with 1 mM EDTA (pH 8.0) and using One Step TB Green PrimeScript PLUS RT-PCR Kit (Takara).
-
bioRxiv - Microbiology 2022Quote: ... Viral load was measured by RT-qPCR using One-Step SYBR® Primescript(tm) RT-PCR kit II (Takara). CT values from serum samples were used to calculate serum viral load according to regression equation built by a set of standard viral RNA extracted from dilutions of known titre virus preparation ...
-
bioRxiv - Developmental Biology 2023Quote: ... TRE3Gs and Tet-ON 3G were amplified by PCR from AAVpro Tet-One Luc Control Vector (Clontech, Cat# 634311), Kaede from in-house recombineering cassette (Zheng et al. ...
-
bioRxiv - Microbiology 2024Quote: ... the dish was split into two 1-ml Petri dishes and one was treated with rapalog (250 nM, Clontech) for 4 hours to induce the knock-sideway while the other served as control.
-
bioRxiv - Biochemistry 2019Quote: ... cochleariae fat body for 3’ rapid amplification of cDNA ends (3’ RACE) was synthesized according to the manual from SMARTer RACE 5’/3’ Kit (Takara Bio, Inc. Mountain View, CA, USA). All cDNA templates were stored at −20 °C after synthesis.
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (TaKaRa bio. Inc., Shiga, Japan). The vector was transformed into XL1-Blue Escherichia coli competent cells (GMbiolab Co. ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2 (Dye Plus; TaKaRa, Dalian, Japan), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Lenti-X concentrator (PT4421-2, Clontech) was mixed at the ratio of 1:3 and incubated at 4 °C for a short time ...
-
bioRxiv - Cell Biology 2021Quote: ... and doxycycline (2 mg/ml, Clontech). After 6 hours ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2 mM DTT (Takara Bio, #639537), 1 mM dNTPs (Takara Bio ...