Labshake search
Citations for Takara Bio :
651 - 700 of 2479 citations for 6H Imidazo 4 5 1 de acridin 6 one 5 3 diethylamino propyl amino 8 hydroxy since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... Cytosolic domain fragments of NbPMA3 (F1, F2 or F3) were fused with the Gal4 activation domain in pGADT7 (Clontech, PT3249-5, USA) and inserted into the Y187 strain under selection with SD/-Leu ...
-
bioRxiv - Physiology 2022Quote: ... A total of 5 μg of each protein was subjected to trypsin treatment using a captured trypsin column (TAKARA, 635722, Shiga, Japan). After trypsin treatment ...
-
bioRxiv - Neuroscience 2024Quote: ... was amplified by PCR and inserted into the Cre-dependent AAV hSyn FLEx vector using BamHI/KpnI restriction sites.pTet-on (transactivator) was purchased from Clontech (Clontech; #P3070-5). Plasmids were prepared using the ZymoPURE Plasmid MaxiPrep Kit (Zymo Research ...
-
bioRxiv - Neuroscience 2023Quote: ... ESCs were seeded at 1 × 105 cells per well and maintained on the dishes at 37°C in 5% CO2 under humidified conditions with a 3i culture medium (Y40010, Takara Bio, Japan) without feeder cells ...
-
bioRxiv - Bioengineering 2024Quote: ... The plasmid pmCherry was generated by fusing the lacI-Ptrc inducible system and mCherry into the vector pBBR1MCS-5 using In-Fusion® Snap Assembly Master Mix (Takara Bio). All plasmids were extracted using QIAprep® Spin Miniprep Kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3’ RACE was performed using 3’-Full RACE Core Set (TaKaRa, Kusatsu, Japan). PCR amplification on the 3’ UTR regions of AtCFI25a ...
-
bioRxiv - Microbiology 2021Quote: ... One-Step TB Green PrimeScript PLUS RT-PCR Kit (Takara Bio) was used under the following conditions ...
-
bioRxiv - Microbiology 2021Quote: ... with the high-fidelity One Step RT-PCR Kit (Takara Bio). PCR products were gel purified and cloned into the pCR4-TOPO vector using the Zero Blunt Topo Cloning Kit (Invitrogen) ...
-
bioRxiv - Developmental Biology 2020Quote: ... Embryos were grown one more day in NDiff 227 media (Takara) supplemented with 1 µM PDO325901 and 3 µM CHIR99021 (NDiff + 2i) ...
-
bioRxiv - Biochemistry 2021Quote: ... One-step PrimeScript™ RT Reagent Kit (Takara, Japan, Cat.#RR064A) Kit were used for quantitative real-time PCR ...
-
bioRxiv - Microbiology 2020Quote: ... One step TB green Primescript RT-PCR kit II (Takara, RR086B) was used for qPCR reaction on Quantstudio 6 Flex system (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2023Quote: ... pombe genome using KOD One DNA polymerase (TaKaRa Bio Inc., Japan). The first PCR products were used as primers in the second PCR step to amplify a cassette for integration ...
-
bioRxiv - Biochemistry 2019Quote: Hexa-histidine-tagged scaffolding protein (6 mg) was loaded on a 1 ml immobilized metal affinity chromatography column charged with cobalt (Clontech). Coat protein monomers (0.2 mg/ml ...
-
bioRxiv - Cancer Biology 2019Quote: ... 6×106 Lenti-X 293T (Takara Bio #632180) cells were seeded in a 10 cm dish the day prior to transfection ...
-
bioRxiv - Immunology 2021Quote: ... 6 U Recombinant RNase Inhibitor (Takara, Cat#2313A) and 50 U Superscript III reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Libraries were prepared from <=2.5ng input RNA using 1/4 volume SmartSeqv4 technology (Takara Bio) and sequenced on NextSeq High Output flow cells ...
-
bioRxiv - Biochemistry 2020Quote: ... The DHTKD1 open reading frame (amino acids 25-919) was amplified using PrimeSTAR GXL DNA Polymerase (Takara) and primers forward (5’-GGT TTA GAA TTC ATG CAG ACC GAG CGG GGC GTT TA-3’ ...
-
bioRxiv - Microbiology 2021Quote: ... The sequence encoding amino acids 2-1273 were cloned into a shuttle plasmid following InFusion cloning (Clontech). The shuttle plasmid encodes a modified human cytomegalovirus major immediate early promoter (IE CMV ...
-
bioRxiv - Cell Biology 2020Quote: Murine GFP-CIZ1 (845 amino-acids) and GFP-CIZ1Δ2p6p8 (formerly known as ECIZ1) in pEGFP-C3 (Clontech) were described previously (Coverley et al. ...
-
bioRxiv - Microbiology 2023Quote: ... and double amino acid mutations were introduced using PrimerSTAR® Max DNA Polymerase (# R046A, Takara Bio Inc.). The primers used for the mutation generation were listed in SI data.
-
bioRxiv - Cell Biology 2021Quote: ... Fibroblast cultures at passage 3 were cryopreserved by suspending cells in CELLBANKER 1 (Takara Bio, Shiga, Japan), slowly cooled to -80 °C using a Mr ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Microbiology 2022Quote: ... Membrane was immunoblotted for ≥ 3 h with primary monoclonal anti-GFP (1:5,000) antibodies (JL8, Clontech-Takara), then followed by immunoblotting for ≤ 1 h with secondary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... 3% normal goat serum (NGS) and then incubated overnight with 1:2000 rabbit-anti-DsRed (632496, Clontech) (Geerling et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... and an extra 15 bp at the 3’ and 5’ ends allowing their insertion into the linearized NheI-PacI pUASt-5C plasmid using In-Fusion cloning strategy (Takara Bio USA, Inc.).
-
bioRxiv - Cell Biology 2022Quote: ... 1.0~5 μg of total RNA was reverse-transcribed in a 20-μl reaction containing 1x RT buffer (Clontech, Mountain View, CA, USA), 0.5 mM dNTPs ...
-
bioRxiv - Microbiology 2021Quote: ... the cDNAs were reverse-transcribed from 5 µg of total RNA with the PrimeScript™ II 1st Strand cDNA Synthesis Kit (TaKaRa, Dalian, China). Real time PCR (qPCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Single cells were collected into individual wells of 96 well-PCR plates containing 9.5 μL/well of freshly made lysis buffer (provided in SMART-Seq v4 Ultra Low Input kit for Sequencing (Takara Bio USA #634893)) ...
-
bioRxiv - Pathology 2020Quote: ... 1.0~5 μg of total RNA was reverse-transcribed in a 20-μl reaction containing 1x RT buffer (Clontech, Mountain View, CA, USA), 0.5 mM dNTPs ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Microbiology 2023Quote: ... The mixture was subjected to three freeze-thaw cycles at -80 °C and 37 °C and treated with 5 units of DNase I (TaKaRa Bio, Otsu, Japan) and 20 ng RNase (Nippon Gene ...
-
bioRxiv - Molecular Biology 2024Quote: ... Membranes were blocked in 5% Skim milk powder (Fujifilm, Cat# 190-12865) with Phosphate buffered saline with tween® (PBS-T) (Takara, Cat# T9183). The primary antibody was incubated overnight at 4°C ...
-
bioRxiv - Molecular Biology 2024Quote: ... membranes were then blocked in 5% Skim milk powder (Fujifilm, Cat# 190-12865) mixed with Phosphate buffered saline with tween® (PBS-T) (Takara, Cat# T9183). The chosen primary antibody was then incubated overnight at 4°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Equal quantities (5 ng) of total RNA from each sample were used for cDNA synthesis using the PrimeScript®RT reagent kit (TaKaRa, Tokyo, Japan). The reverse transcriptions of miRNAs were performed using looped miRNA-specific RT primers for miRNAs ...
-
bioRxiv - Cell Biology 2020Quote: ... transfected with relevant siRNA were seeded on to 8–well chamber slides and treated with 1 μM Sheild1 (632189, Clontech Laboratories UK Ltd) and 1 μM 4–hydroxytamoxifen (4–OHT ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 × 106 HEK293T cells (Clontech) were seeded on a 10 cm cell culture dish and transfected after 24 h with GenJet transfection reagent (SignaGen) ...
-
bioRxiv - Microbiology 2023Quote: ... Shield1: 1.5-3 µM (Takara). With the exception of time-course experiments ...
-
bioRxiv - Neuroscience 2020Quote: ... The following primary antibodies were used: GFP (JL-8, Clontech, #632381), Tubulin (Covance ...
-
bioRxiv - Cell Biology 2021Quote: ... JL-8 anti-GFP monoclonal antibody (TaKaRa, catalog # 632381, lot # A8034133) at 1:2,000 dilution ...
-
bioRxiv - Plant Biology 2020Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-CHS (sc-12620 ...
-
bioRxiv - Cell Biology 2021Quote: ... Monoclonal mouse anti-GFP antibodies (JL-8) were from Clontech (632381). Monoclonal mouse anti-Flag (M2 ...
-
bioRxiv - Genomics 2022Quote: ... 16 µL 100x DAPI and 8 µL ICELL8 Second Diluent (Takara) were added and incubated 10 minutes at RT ...
-
bioRxiv - Immunology 2022Quote: ... mouse anti-GFP clone JL-8 (Takara Bio Cat# 632380, RRID:AB_10013427), rabbit anti-FLAG clone D6W5B (Cell Signaling Technology Cat# 14793 ...
-
bioRxiv - Plant Biology 2021Quote: ... anti-GFP (Living Colors® A.v. Monoclonal Antibody, JL-8; Clontech), anti-HY5 (Oravecz et al. ...
-
bioRxiv - Bioengineering 2022Quote: ... EGFP was detected using the JL-8 mouse monoclonal antibody (Clontech). For IHC ...
-
bioRxiv - Molecular Biology 2022Quote: ... GFP expression was verified using immunoblotting using GFP (JL-8-Clontech) and α-tubulin (CP06 Calbiochem ...
-
bioRxiv - Molecular Biology 2023Quote: ... Membranes were then incubated with anti-GFP antibody (JL-8; Clontech) at a dilution of 1:5,000 ...
-
bioRxiv - Biochemistry 2023Quote: ... GFP expression was verified using immunoblotting using GFP (JL-8, Clontech) and α-tubulin (CP06 ...
-
bioRxiv - Developmental Biology 2021Quote: A library scale transformation was performed on each of Dmef2-HIS + 22-Twist and tinman-HIS + 22-Twist strains using a 0-6 hr Drosophila embryonic library (a gift of L. Pick) according to the manufacturer’s instructions (Clontech PT3024-1). Transformations were plated on 150mm plates containing 12.5mM 3-AT ...
-
bioRxiv - Genomics 2020Quote: ... total RNA was reverse-transcribed with the PrimeScript One Step Kit (Takara) using gene-specific primers for GFP (CAAACTCATCAATGTATCTTATCATG ...