Labshake search
Citations for Takara Bio :
651 - 700 of 2420 citations for 6H Furo 3 2 d 1 3 dioxin 6 one 4a ethoxytetrahydro 2 2 dimethyl 4aR 7aR 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2023Quote: ... A volume of 2 μg of total RNA was reverse transcribed into single-stranded cDNA using AMV reverse transcriptase (TaKaRa, Dalian, China). The primer sequences used for qRT-PCR are listed in Supplementary file 1b ...
-
bioRxiv - Genetics 2023Quote: ... RNA from 2 retinae of a mouse was extracted using the NucleoSpin® RNA kits (Takara Bio USA, Inc., San Jose, CA). RNA sample concentration and quality was determined with NanoDrop Oneᶜ Microvolume UV-Vis Spectrophotometers (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2023Quote: ... cDNA library was generated from 2 nanograms of total RNA using Smart-Seq V4 Ultra Low Input RNA Kit (Takara catalog#: 634894). 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog# ...
-
bioRxiv - Plant Biology 2023Quote: ... genomic sequences at the length of 700∼2 000 bp were amplified from genomic DNAs with PrimeStar Max DNA polymerase (Takara, cat. R045A). The resulting fragments were cloned into vector backbones derived from pPY22 (mNeonGreen-Hygromycin B ...
-
bioRxiv - Cell Biology 2024Quote: ... A volume of 2 µl of cDNA was used as template for qPCR using SYBR Premix Ex Taq (Takara, Shiga, Japan, #RR420A). qPCR reactions were performed using an ABI 7500 system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2022Quote: ... The dialyzed fraction was mixed for 3 h with Talon Metal Affinity Resin (Clontech) that had been equilibrated with Buffer T ...
-
bioRxiv - Microbiology 2021Quote: ... we performed RACE PCR using a SMARTer® RACE 5’/3’ Kit (Takara Bio), according to the manufacturer’s specifications ...
-
bioRxiv - Molecular Biology 2021Quote: ... 5’ RACE cDNA library was prepared using Clontech SMARTer RACE 5’/3’ Kit (Takara) according to the user manual with the gene-specific primer (S4 Table ...
-
bioRxiv - Molecular Biology 2019Quote: ... DNA fragments larger than 3 kb were amplified with PrimeSTAR Max (Clontech Laboratories, Inc.); all other PCR products were amplified with PrimeSTAR HS DNA polymerase (Clontech Laboratories ...
-
bioRxiv - Genomics 2019Quote: ... 9.0 μL of 3 SMART™ CDS Primer II A (12 M, Clontech, 634936), and 1.4 μL of Loading Reagent (20X ...
-
bioRxiv - Genetics 2020Quote: ... A 3′-dephosphorylation and 5′-phosphorylation reaction was performed using T4 PNK enzyme (TaKaRa). The enzyme was removed by phenol-chloroform purification ...
-
bioRxiv - Molecular Biology 2020Quote: ... The plasmids were co-transformed pairwise into AH109 yeast strains (Matchmaker 3 System, Clontech), and selected initially on double drop-out (DDO ...
-
bioRxiv - Molecular Biology 2023Quote: ... 14-3-3γ CDS was amplified by PCR and subcloned into pCMV-mCherry (Clontech). Deletion and point mutations of SMAUG1 were created using Q5 site-directed mutagenesis kit (NEB) ...
-
bioRxiv - Plant Biology 2023Quote: Y2H assays were performed with the MatchMaker GAL4 Two-Hybrid System 3 (Takara Bio). Saccharomyces cerevisiae strain AH109 was co-transformed with different pairs of pGADT7 and pGBKT7 harboring IREH1 or B1-Rafs ...
-
bioRxiv - Microbiology 2019Quote: ... flanked by a 5’ terminal Kozak sequence and 3’ terminal stop codon into the Nhe1 and Sal1 sites of pIRES2-EGFP (Clontech cat # 6029-1).
-
bioRxiv - Cell Biology 2020Quote: ... and Evl (isoform 2) were amplified by PCR from a NIH 3T3 cDNA library and ligated into suitable sites of pEGFP-C1 (Clontech, Palo Alto, CA). VASP cDNA was additionally inserted into the BglII and SalI sites of pmCherry (Addgene ID ...
-
bioRxiv - Plant Biology 2020Quote: ... About 2 μg of the isolated RNA was used to synthesize the first-strand cDNA using reverse transcriptase enzyme (Takara Bio, Clontech, USA). The cDNA was diluted seven times with sterile Milli-Q water (1:7 ratio) ...
-
bioRxiv - Cell Biology 2022Quote: ... Transformants were selected on synthetic media containing yeast nitrogen base (YNB, Difco) supplemented with 2 % glucose and DropOut supplements lacking uracil (Clontech, Mountain View, CA). Single colonies were used to inoculate 5 mL liquid YNB media supplemented with 2 % glucose and DropOut supplements lacking uracil ...
-
bioRxiv - Molecular Biology 2019Quote: ... Klotho genotypes were determined by semi-quantitative PCR using LA-Tag DNA polymerase and TaKaRa buffer with Mg+2 (TaKaRa Shuzo, Tokyo, Japan) as follows ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The SARS-CoV-2 viral load was quantified in culture supernatant using RT-QPCR with primer probes targeting E gene of SARS-CoV-2 using PrimeDirect Probe RT-qPCR Mix (TaKaRa Bio USA, Inc) and Applied Biosystems QuantStudio3 real-time PCR system (Applied Biosystems ...
-
bioRxiv - Immunology 2020Quote: ... the 5×PrimeSTAR® Buffer (Mg2+ plus) in the kit was replaced with the 2 × PrimeSTAR® GC Buffer (Mg2+ plus) (Takara, Japan). The first PCR program was as follows ...
-
bioRxiv - Cell Biology 2022Quote: ... containing a Kozak sequence added right before the ATG (RefSeq NC_045512.2) were synthesized by Eurofins (Ebersberg, EU) and subcloned into the pIRES2 vector with eGFP in the second cassette (Takara Bio Europe, EU). Truncated Δ4 and Δ8 E proteins ...
-
bioRxiv - Genetics 2022Quote: ... reverse transcription was carried out using 2 μL of RNA mixed with 4 μL of 5×PrimeScript IV cDNA Synthesis Mix (Takara, Code No. 6215A) containing PrimeScript IV RTase ...
-
bioRxiv - Molecular Biology 2023Quote: ... was performed by quantitative real-time polymerase chain reaction (PCR) using the AAVpro™ Titration Kit (for Real Time PCR) Ver.2 (Takara Bio Inc), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... and was then incubated with 2 mL TBS pH 8.0 pre-equilibrated Talon® Metal Affinity resin during 2 h at 4°C with permanent mixing (Takara Bio, Kusatsu, Japan). The resin was washed with 10 volumes of TBS pH 8.0 buffer containing 0.1% Triton X-100 and 10 mM imidazol (both from Sigma) ...
-
bioRxiv - Immunology 2023Quote: ... which was measured using a real-time PCR assay with a SARS-CoV-2 direct detection RT‒qPCR kit (Takara Bio, Siga, Japan). The IC50 was calculated by IC50 Calculator (https://www.aatbio.com/tools/ic50-calculator ...
-
bioRxiv - Genetics 2024Quote: ... PCR was conducted as described earlier (section: RNAi-mediated knockdown of Pmtra-2) but using the proofreading PrimeSTAR HS DNA Polymerase (Takara Bio, Shiga, Japan) and Ex Taq DNA Polymerase (Takara Bio ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... adhaerens yeast 2-hybrid cDNA library was constructed using the Make Your Own “Mate & PlateTM” Library System (Takara Bio USA, Mountain View, CA), using whole animal total RNA extracted from approximately 30 animals using a Nucleospin RNA Plus Mini Kit (Macherey-Nagel ...
-
bioRxiv - Microbiology 2021Quote: ... UK) containing the 27F/1492R primer set and MightyAmp DNA polymerase Ver.3 (Takara Bio). PCR was performed according to a previous report (Fujiyoshi et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... To ensure we had the full-length transcript we performed 3’RACE (SMARTer RACE Takara) using a forward primer 5’-GGAGCACAGACCAATGGAGC-3’.
-
bioRxiv - Plant Biology 2021Quote: ... benthamiana plants was used for 5’ RACE with SMARTer RACE 5’/3’ Kit (Takara, Japan) according to the manual booklet.
-
bioRxiv - Microbiology 2020Quote: ... single-stranded (ss) cDNA (sscDNA) was synthesized using the SMARTer RACE 5′/3′ Kit (Takara) with a U2-complementary primer ...
-
bioRxiv - Cancer Biology 2021Quote: ... were prepared using the SMARTer ICELL8 3 ‘DE Reagent Kit V2 (Takara Bio, Cat # 640167) from isolated nuclei ...
-
bioRxiv - Microbiology 2022Quote: ... the 5′-terminus of the viral genome was determined by 5′/3′ RACE kits (TaKaRa). The resulting whole genome sequence of the GX_P2V variant was deposited in GenBank (accession number MW532698) ...
-
bioRxiv - Cell Biology 2022Quote: Yeast-two-hybrid analysis was performed with the MATCHMAKER GAL4 Two-Hybrid System 3 (Clontech) essentially as described (39) ...
-
bioRxiv - Microbiology 2020Quote: The putative 3’ UTR of FOXO3a was cloned into the dual luciferase reporter pSiCheck2 (Clontech) using the following primers ...
-
bioRxiv - Microbiology 2020Quote: ... The terminal sequences were recovered using a SMARTer® RACE 5’/3’ Kit (Takara, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2022Quote: ... mouse DPPA3 cDNA was sub-cloned into a pGEX4T-3 plasmid using In-Fusion (Clontech) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: RNA-seq libraries for gene expression were constructed using Clontech SMARTer v.3 kit (Takara). Small RNA libraries were constructed using NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs) ...
-
bioRxiv - Cancer Biology 2022Quote: ... to the 3’ end of the GFP at the PmeI site using InFusion Cloning (TaKaRa) and screened with PCR and restriction digests (Supplementary Table S8) ...
-
bioRxiv - Synthetic Biology 2022Quote: Retroviral/lentiviral transductions were performed on days 3 and 4 post activation on retronectin (Takara) coated non-tissue culture treated plates ...
-
bioRxiv - Molecular Biology 2023Quote: Rapid amplification of cDNA ends was performed using the SMARTerR RACE 5’/3’kit (Takara), us 1 μg of DNA-free RNA from zeocin-treated samples as template for first-strand cDNA synthesis according to manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 μl of cold Poly-A-tailing master mix (3.3x Smartscribe first strand buffer (Takara), 0.16 U/μl Poly-A-polymerase (2180A ...
-
bioRxiv - Cancer Biology 2023Quote: 3’ and 5’RACE reactions were carried out using the SMARTer 3’5’ RACE kit (Takara), essentially as recommended by the manufacturer ...
-
bioRxiv - Molecular Biology 2019Quote: ... This region was PCR amplified with DinoSL and KbrSRP-U6R1 primer set (sequences and Tm in Table 2) using the high fidelity PrimeSTAR HS DNA Polymerase (Takara, Kusatsu, Shiga Prefecture, Japan) at 94°C for 1 min ...
-
bioRxiv - Cell Biology 2021Quote: ... fragments #1 and #2 were inserted into the PB-EF1-MCS-IRES-Neo vector using the In-Fusion HD Cloning Kit (639648; Takara Bio Inc. Kusatsu, Japan). This resulted in the PB-EF1-MCS-IRES-Zeo vector ...
-
bioRxiv - Bioengineering 2019Quote: KOD-Plus-Ver.2 DNA polymerase (Toyobo, Osaka, Japan) was used to amplify ldsDNAs (PCR amplicons) using the pEGFP-C1 (Clontech, Mountain View, CA, USA) plasmid as the template ...
-
bioRxiv - Cancer Biology 2022Quote: Tgfb-Induced-Enhancer:Beta-globin-minimal-promoter-EGFP:pA pDestTol2pA2 was cloned by PCR amplifying the enhancer (chr1:22747452-22747734) in Figure 1A using A375 human melanoma gDNA (Forward primer: TTCTTTGTCATCCTGGTAGAGCAAATCGAG, Reverse primer: GACAGGTCGCACCTGAGTCC)(Advantage® 2 PCR Kit, Clontech #639207, Kyoto, Japan). PCR product was gel purified (Qiagen #28604 ...
-
bioRxiv - Cell Biology 2022Quote: ... while pGADT7-CmVPS41s and pGADT7-T control prey plasmids were transformed into yeast strain Y187 following the Yeastmaker Yeast Transformation System 2 instructions (Clontech by Takara Bio, Mountain View, USA). The transformed cells were grown either in SD-Trp agar plates for Y2HGold or in SD-Leu agar plates for Y187 at 30 ºC for 3-5 days ...
-
bioRxiv - Bioengineering 2024Quote: ... To synthesize cDNA, total RNA (8 µL, ca. 500 ng) was mixed with 2 µL of PrimeScript™ RT Master Mix (Takara Bio, Kusatsu, Japan) and incubated at 37°C for 15 min ...